Garden Management, Education, Information & Training



Yüklə 368 Kb.
PDF просмотр
səhifə9/17
tarix21.08.2017
ölçüsü368 Kb.
1   ...   5   6   7   8   9   10   11   12   ...   17

Chemunji Hills, Agasthyamala Biosphere Reserve
Chemunji Hills, Agasthyamala Biosphere Reserve
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

122
Syzygium  densiorum  Wall.  ex  Wight  &  Arn.,  S. 
occidentalis (Bourd.) Gandhi, S. rama-varmae (Bourd.) 
Chithra, Zenkeria sebastinei Henry & Chandrb.   As per 
the suggestions of the Research Council, geographical 
co-ordinates  of  24  more  endemic  species  from 
Ponmudi  and  Chandanathode  forest  areas  of 
Thiruvananthapuram  and  Wayanad  districts  were 
completed. 
Henckelia  macrostachya  (E.  Barnes)  A.  Weber  & 
B.L. Burtt, a possibily extinct species (Gesneriaceae),  
was collected from the type locality after a long gap of 
75 years. Barnes (1938) had described the species as 
Didymocarpus  macrostschya  Barnes,  based  on  his 
collection  bearing  No.1264,  1266  (Type,  K)  from  the 
High  Range  of  erstwhile  Travancore  during  the  year 
1938. The species is known only from this single locality, 
viz. Ottaparai Ridge, lying at an altitude of 5500 ft., near 
Munnar. The species was recorded as “possibly extinct” 
by  Nayar  &  Sastry  (1997)  which  signies  its 
conservation importance.
Four new species, Sonerila 
veldkampii,  Goniothalamus 
k e r a l e n s i s ,   S y z y g i u m 
palodense  and  Memecylon 
wayanadense  were  described 
from  Kerala.  Lagenandra  nairii 
Ramam.  &  Rajan,  a  local 
endemic  species,  known  only 
from type locality with restricted 
distribution  along  the  water-
l o g g e d   a r e a s   o f   t h e 
downstream  of  Athirappally 
water  falls  in  Thrissur  district 
was relocated from Thusaragiri 
water falls area of Kozhikkodu 
district  and  this  forms  a  new 
distributional record. Likewise, 
Impatiens  minae  Ratheesh 
Narayanan  et  al.  –  hitherto 
known  only  from  the  type 
locality, Chembra Peak (c.1600 
m)  in  Wayanad  district,  was 
relocated from the high altitude 
region of Anamalai,   Pettimudi 
(c.  1800  m)  of  Idukki  district  
which  is  another  extended 
distributional record.
Collection  of  some  local 
endemic  (distribution  <  5  sq. 
km.)  species  like  Habeneria 
r o x b u r g h i i   N i c o l s o n , 
Humboldtia  brunonis  Wall  var. 
raktapushpa    Udayan  et  al
(Fabaceae),  Ixora  sivarajanii 
Pradeep  (Rubiaceae),  Leucas  beddomei  (Hook.  f.) 
Sunoj  et  al.  (Lamiaceae),  Eugenia  argentea  Bedd. 
a. Henckelia macrostachya (E. Barnes) A. Weber & B.L. Burtt; b. Parasopubia hofmannii 
Pradeep & Pramod; c & d. Sonerila veldkampii Ratheesh Narayanan et al
Drosera indica L.
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

123
(Myrtaceae) have enriched the herbarium  and also  is 
signicant from their conservation point of view.
A  study  was  initiated  on  the  mangroves  of 
Puthuvypin  -  Vembanad  Wetland  (Ramsar  Site), 
Ernakulam  District,  Kerala,  to  evaluate  species 
abundance  and  diversity  of  true  mangroves  and 
associated  species  as  these  mangrove  patches  in 
Kerala had diminished in their extent drastically and had 
acquired a threatened status. Puthuvypin is the single 
largest  stretch  of  mangrove  vegetation  (c.101  Ha)  in 
Kerala coming under Vemband Wetland (Ramsar Site) 
ecosystem in Ernakulam district. This unique vegetation 
with their specialized ecological characteristics creates 
a suitable habitat for both ora and fauna.  But ironically, 
more  than  23  acres  of  this  fragile  ecosystem  coming 
under Coastal Regulation Zone - 1 (CRZ-1) has been 
transformed into an industrial hub.   Preliminary study 
revealed  that  there  remained  only  are  12  true 
mangroves and 21 mangrove associated species out of 
the15  mangroves  and  49  mangrove  associates 
reported earlier.  About 175 herbarium specimens were 
processed,  identied  and  incorporated  into  the 
herbarium.
The  project  on  Germplasm  Documentation, 
Evaluation, Ex-situ Conservation and Popularization of 
Local Mango Varieties in Kerala was aimed at producing 
sufcient  quantities  of  planting  materials  of  the 
promising types for cultivation and thus  conserving the 
fast depleting wild mango varieties with a view to tap the 
potential of their genetic resources for future breeding 
programmes. 84 local mango varieties were collected,  
identied  and  plus  trees  were  marked  for  further 
evaluation. The voucher specimens were processed for 
future  studies.  The  seeds  in  bulk  quantities  were 
collected  for  propagation.  A  humidity  controlled 
chamber was constructed in the mango conservatory. 
a. Puthuvypin - Vembanad Wetland (Ramsar Site), Ernakulam District, Kerala; b. Bruguiera cylindrica (L) Blume; 
c. Bruguiera gymnorrhiza  (L) Savigny; d. Sonneratia caseolaris (L.) Engl. 
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

124
Local Mango varieties of Kerala: a. Kalkanda varikka; 
b. Kolambi; c. Mayipeeli; d. Njettukuzhiyan; e. Vellari; 
f. A view of Mango Nursery.
Morphometric  analysis  of  the  fruits  and  seeds  of  33 
varieties was completed, differences recorded and the 
data processed for further studies. Even though 40,000 
seeds  were  collected  from  the  eld,  we  could  raise 
seedlings  of  50%  only  because  of  continuous  and 
intermittent  rain  and  wild  boar  attack.  The  rescued 
seedlings  have  been  nurtured  well  in  the  mango 
conservatory  of  JNTBGRI.  Simultaneously  ex-situ 
conservation  of  the  local  mango  varieties  is  currently 
progressing  in  the  5  hectares  of  area  allotted  for  the 
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

125
project in the garden site. In addition, market surveys 
were  also  conducted  and  analysed  to  nd  out  the 
diversity of the value added products made out of local 
mango varieties in the State and the seasonal inux of 
diverse varieties of mangoes in the local markets.
Survey, inventory and sustainable 
evaluation of mushrooms of Western 
Ghats
The Indian subcontinent is known worldwide for its 
varied  agro-ecological  characteristics  and  rich 
biodiversity  of  ora  and  fauna.  Kerala,  oristically  the 
richest state, provides a wide variety of habitats for the 
luxuriant  growth  of  fungi.  But  the  mushroom  diversity 
today is facing the threat of being lost forever owing to 
the fast and continuing decline in their habitats due to 
population explosion and developmental activities. For 
any meaningful conservation exercise to succeed, the 
primary  emphasis  should  obviously  be  on  the 
assessment  of  the  bio-diversity  based  on  survey, 
collection and identication. With this view, three major 
research programmes were undertaken to evaluate the 
macro-fungal wealth of Kerala. The main objectives of 
these programmes were to recognize the lesser known 
wild edible mushrooms of Kerala; to develop cultivation 
protocols for the promising edible ones and to establish 
a regional reference centre for mushrooms.
The study on Wild edible mushrooms of Kerala was 
aimed at collecting and documenting the common and 
lesser known wild edible mushrooms of Kerala forests 
so that they can be safely gathered and utilized without 
ill effects by the local people who gather them for food. 
The study listed 85 taxa of wild edible mushrooms from 
Kerala  representing  25  genera  under  13  families.  
Important among these are the three promising giant 
mushroom  species  -  Pleurotus  giganteus  (Berk.) 
Karunarathna & K.D. Hyde, Macrocybe lobayensis( R. 
Heim),  Pegler  &  Lodge  and  Macrocybe  titans    (H.E. 
Bigelow & Kimbr.) Pegler,  Lodge & Nakasone.
As part of the programme Inventory, documentation 
and development of cultivation protocol for the lesser 
known wild edible mushrooms of Kerala, extensive eld 
collection  trips  were  conducted  to  various  forest 
localities of Kerala to collect germplasm of wild edible 
mushrooms. Altogether 427 individual collections were 
made  from  the  forests  of  Wayanad,  Nilambur, 
Kozhikode, Thenmala, Kulathupuzha, Kallar, Ponmudi, 
Palode and JNTBGRI campus. Out of these, 11 species 
belonged  to  the  edible  category.  Wild  edible  species 
collected  were  used  for  developing  pure  cultures  in 
different media such as PDA, MEA, CDA, YEA, YEGA & 
PMA  under  aseptic  conditions.  All  the  11  species 
responded well in these media. All the pure cultures are 
maintained  at  JNTBGRI  and  part  of  them  were 
deposited  at  MTCC,  Chandigarh.  Spawn  was 
successfully developed from pure cultures of these wild 
edible  species  and  cultivation  trials  of  Agaricus 
squamuliferus (F.H. Moller) Pilat, Oudemansiella canarii 
(Fungh.) Hohn., Lentinus squarrosulus Mont., Pleurotus 
giganteus(Berk.)  Karunarathna  &  K.D.  Hyde  , 
Macrocybe  lobayensis  (  R.  Heim),  Pegler  &  Lodge
a. Entoloma brunneocarnosum Pradeep & Vrinda; b. E. brunneopapillanum Pradeep & Vrinda
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

126
Macrocybe titans(H.E. Bigelow & Kimbr.) Pegler,  Lodge 
&  Nakasone  and  Schizophyllum  commune  Fr.  ex  Fr.,  
using  different  substrata    such  as  saw  dust,  paddy 
straw, sugarcane bagasse, wood shavings, soft wood 
peeling, soft wood logs etc., under normal conditions 
are being carried out in the laboratory. 
Mushroom Herbarium
During  the  reporting  period,  790  collections 
representing  53  genera  under  16  families  were 
collected, studied and processed for the herbarium. A 
mushroom herbarium with 14,917 specimens is being 
maintained  at  JNTBGRI.  All  materials  of  a  particular 
collection  is  most  appropriately  kept  in  a  packet  of 
standard size made from good quality brown paper or a 
zip  cover  made  of  good  quality  plastic.    Many 
collections  are  duplicates  of  the  same  material 
collected either from the same locality on different days 
or collected from different localities on the same day.  
Each specimen is given a herbarium accession number 
which is unique to that particular collection.   Detailed 
morphological data of each specimen in the herbarium 
i s   a v a i l a b l e   f r o m   t h e   d a t a   b o o k s   a r r a n g e d 
systematically  in  the  laboratory.    All  the  herbarium 
specimens  are  stored  under  controlled  climatic 
conditions  to avoid the attack of moulds and mites.  
Biotechnological Interventions for Conservation 
and utilization of forest resources. [Component - 1: 
Population Structure and Dynamics of Lagerstroemia 
speciosa (L.) Pers.
A  network  project  is  being  implemented  with  the 
nancial  support  of  DBT,  Govt.  of  India.    Apart  from 
JNTBGRI,  University  of  Agricultural  Sciences, 
Bangalore and Natural Remedies Pvt. Ltd., Bangalore 
are the collaborating centers.
The candidate species Lagerstroemia speciosa is a 
deciduous element showing tolerance to drought and 
heat  during  summer  and  humidity  during  monsoon.  
The plant shows a wide range of pH tolerance, soil types 
from  mostly  sandy  to  clay,  a  water  range  from  dry  to 
moist etc.   The tree is a potential source of Corosolic 
acid, which is known for its anti-diabetic activity.   The 
plants also possess anti-inammatory and anti-cancer 
activity.  Against this background, the DBT sanctioned a 
three year multi-institutional project to identify genetic 
variability and high yielding genotypes of L. speciosa for 
Corosolic  acid  by  analyzing  various  populations  in 
Kerala  and  also  to  study  population  structure  and 
dynamics  to  understand  the  ecological  requirements 
for  implementing  suitable  in  situ  and  ex  situ 
conservation measures for sustainable utilization of the 
species.    Accordingly,  the  Division  was  entrusted  to 
work  on  the  distribution  pattern  and  reproductive 
ecology of the species.
Pe r i o d i c    e l d   v i s i t s   w e r e   c o n d u c t e d   f o r 
understanding the population dynamics of the species 
including    various  reproductive  attributes.  A 
phenological  calendar  of  the  species  was  prepared 
based  on  the  repeated  eld  observations  at  the 
permanently  marked  populations  across  the  State. 
Viable populations at 10 sites across Western Ghats of 
Kerala portion was located and population structure of 
all the 10 sites were worked out.
Around 45 accessions were collected from 10 sites 
a. Entoloma brunneosquamulosum Pradeep & Vrinda; 
b. E. griseolimosum Pradeep & Vrinda
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

127
and subjected to genetic diversity analysis using SSR 
markers.    Samples  were  also  provided  to  Natural 
Remedies,  Bangalore  for  Corosolic  acid  content 
estimation.    The  study  team  was  able  to  identify  an 
accession  from  Malappuram  district  of  Kerala  with 
Corosolic acid content of 0.868 % w/w which is more 
than any other known populations in the entire Western 
Ghats.
As part of the mass multiplication of the identied 
elite clone, air layering was done in the accession of the 
population  at  Chaliarmukku,  Malappuram.    The 
layerings  were  found  to    fail  to  develop  roots  during 
summer season and developed callus.  Around 80 days 
were  needed  for  the  rooting  of  layerages  during 
monsoon period bypassing callus stage.  However the 
establishment rate of the layerages in pots was found to 
be low due to the lack of active buds.   The trials are 
being continued for ne tuning the air layering with the 
objective of developing a stock of viable clones.
Lead Garden Programme
The  Ministry  of  Environment  and  Forests,  Govt.  of 
India  has  recognized  JNTBGRI  as  Lead  Garden  and 
extended nancial support to develop infrastructure to 
meet the Global Target set out by BGCI for conserving 
RET species, promoting Eco-Education and to develop 
conservation  strategies  for  restoration.    Under  this 
programme,  an  RET  Species  Park  was 
developed  for  ex  situ    conservation  of 
extinction  prone  species  and  such  a 
collection  will  act  as  a  gene  sanctuary    for 
future  restoration  programmes.    The  park 
was developed in a 6 acre plot with well laid 
out  landscape  and  irrigation  facilities.    677 
seedlings  of  150  specimens  are  already 
being  conserved.  In  addition  to  this,  834 
seedlings  belonging  to  41  species  were 
further planted. Post planting care and other 
practices are being regularly carried out.
A s   p a r t   o f   t h e   d e v e l o p m e n t   o f 
conservatories, a green house and a shade 
house  are  being  constructed  which  will 
enhance  the  capacity  for  propagating  the 
RET species.  The park has been made clean 
and  tidy  throughout  the  period  by  proper 
weeding,  grass  trimming,  hedge  clipping, 
watering,  summer  mulching,  wild  animal 
protection  etc.  and  is  open  to  visitors 
throughout the year. 
Herbarium Management and 
Development
The herbarium section processed 7228 specimens 
representing  1372  species  during  the  period.    About 
2352  specimens  were  incorporated  to  the  existing 
herbarium.    In  addition,  over  283  enquiries  were 
attended  to  on  identication,  certication,  processing 
techniques  etc.  The  Travancore  Herbarium  contains 
about  2000  specimens  which  were  rearranged  in  the 
rst oor of the herbarium.
The  Survey  conducted  for  enrichment  of  the 
herbarium has led to the collection of many rare species 
and  form  new  additions  to  the  herbarium.    The 
important collections include Henckelia macrostachya 
(Barnes) A. Weber & B. L. Burtt, Hopea erosa (Bedd.) 
Slooten,  Impatiens  elegans  Bedd.,  Impatiens  johnii 
Barnes, Lasianthus blumeanus Bedd., Litsea beddomei 
Hook.f., Memecylon heyneanum Benth. Ex Wight & Arn., 
Shorea roxburghii G.Don, Premna paucinervis (Clarke) 
Gamble,  Piper  pseudonigram  Velaydhan  &  Amal
Psychotria  macrocarpa  Hook.f.,  Pogostemon 
travancoricus  Bedd.,    Syzygium  bourdillonii  (Gamble) 
Rathkr. & N.C.Nair, Syzygium densiorum Wall. ex Wight 
&  Arn.,  Syzygium  myhendrae  (Bedd.  ex  Brandis) 
Gamble,  Syzygium  rama-varmae  (Bourd.)  Chithra, 
Zenkeria sebastinei Henry & Chandrb. etc. 
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

128
Microbiology  
Division of
Microbial Bioprospecting
Isolation and cloning of keratinolytic 
serine protease and antifungal 
chitinase genes
The  keratinases  have  high  activity  for  insoluble 
protein  substrates  such  as  keratin.  The  strain 
Streptomyces  sp  S13A5  which  has  strong  hydrolysis 
activity  on  bird  feathers  was  reported.  A  keratinolytic 
serine protease designated S13ap was partially puried 
and some enzymatic properties were examined. S13 ap 
has an approximate molecular weight of 30 kDa and the 
optimum pH and temperature for keratinolytic activity 
0
was found to be 9.0 and 70 C respectively. Isolation and 
cloning  of  keratinase  genes  are  essential  to  ensure 
improved  enzyme  yields  for  commercialization.  In 
addition, nucleotide sequences serve as a prelude to 
phylogenetic  analysis  of  enzymes  and  assist  in 
deciphering structure function relationships. In view of 
the industrial interest in these enzymes, methods that 
involve  recombinant  DNA  technology  and  genetic 
engineering  has  been  developed  to  explore  their 
potential.
Bacterial  strains,  plasmids 
a n d   g r o w t h   c o n d i t i o n s : 
Streptomyces  sp  S13A5  with 
high  feather  degrading  activity 
was  grown  in  Sabouraud's 
dextrose broth . Escherichia coli 
DH  5α  was  grown  in  Luria  – 
Bertani  (LB)  broth  or  agar. 
Whenever needed, the medium 
w a s   s u p p l e m e n t e d   w i t h 
ampicillin  (100  mg/ml)  or 
kanamycin (50 mg/ml). T4 DNA 
l i g a s e   a n d   a l l   r e s t r i c t i o n 
enzymes were purchased from NEB.   Plasmid vectors 
like pGEMT, pXcm kn12 and pET 28a were used in the 
cloning and expression study. The primers used in this 
study are listed in Table 1.
Cloning and sequencing of 16s rDNA to identify the 
phylogeny:  Genomic  DNA  from  the  selected  isolate 
Streptomyces  sp  S13A5  was  obtained  by  using 
bacterial  genomic  DNA  extraction  kit  (Hi  Media).  The 
16s  rDNA  gene  was  amplied  by  PCR  using  forward 
primer  27F  and  reverse  primer  1495R.  Amplied 
fragments were cloned on to pGEMT vector.
Cloning  and  expression  of  keratinase  gene: 
Sequence  homology  studies  of  the  keratinase  gene 
available in GenBank indicate that they mostly belong to 
subtilisin family of serine proteases, sharing signicant 
structural and sequence similarities (98%). Five forward 
primers and one reverse primer were designed for the 
present study. The thermal program used to amplify the 
sequence  included  one  cycle  with  5  min  DNA 
0
0
0
denaturation at 95 C, 35 cycles of 95 C (45sec), 58 C 
0
(45  sec)  and  72 C  (2  min),  plus  one  additional  cycle  
0
with  a  nal  7  min  chain  elongation  at  72 C.The  PCR 
reaction mixture contained 10µM of each primer,  1X of 
amplication  buffer,  25  mM  dNTPs,  and  taq  DNA 
polymerase    in  25µl  total  volume.  PCR  reaction  was 
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

129
carried out in thermal cycler. Cloning of keratinase gene 
sequences is progressing. 
Antifungal  chitinase  (Family-19  chitinase)  is  a 
potential  enzyme  with  application  in  the  biocontrol  of 
fungal pathogens in agriculture and food grain storage. 
Two  of  our  laboratory  strains  Streptosporangium 
n o n d i a s t a t i c u m   T B G 7 5 A 2 0   a n d 
Streptomyces  clavifer  TBG-MNR13  are  with 
promising  antifungal  properties.  These 
strains were further screened for their fungal 
cell  wall  lytic  enzymes  (chitinase)  using 
analysis  of  degrading  colloidal  chitin  and 
fungal chitin.       S. nondiastaticum was more 
potential and its chitinase gene was targeted 
by  PCR  technology  using  degenerative 
primers  designed  based  on  the  conserved 
regions in actinobacterial family-19 chitinase 
genes.
Chitinase  activity  of  Streptosporangium 
no ndias t at ic um   TB G 75A 20:  Pr ima r y 
screening for chitininolytic activity was done 
by  inoculation  of  the  organism  in  colloidal 
chitin agar medium containing 0.2% colloidal 
chitin. The plates were incubated at 27+ 1˚C 
for a period of 3 days and stained using 0.2% 
Congo  Red  solution.  The  plates  were  then 
destained  using  4M  NaCl .  A  zone  of 
2
clearance  of  3  cm  diameter  was  seen  in 
rd
colloidal chitin agar on 3  day when stained 
with Congo Red (Fig. 1). The zone formation is 
due  to  the  chitinolytic  property  of  enzymes 
produced by the organism. 
Genomic DNA isolation and PCR of Chi 
gene: Genomic DNA was extracted following 
the method of Murray and Thompson (1980). Four sets 
of  primers  were  used  for  PCR  basedchitinase  gene 
amplication. The primers used are: 
Positive results were obtained in PCR amplication 
of  chitinase  gene  using  3  set  of  primers  namely 
CHICF,CHICR; F19F2, F19R and FWCHI35, RVCHI35. 
Amplication  using  CHICF,CHICR  primers  gave  4 
bands  while  F19F2,  F19R  and  FWCHI35,  RVCHI35 
produced single bands. Primers CHI19F and CHI19R 
did  not  give  any  amplication.  16S  rDNA  amplication 
using the primers 27F and 1495R gave a single band (Fig. 
2).  The  PCR  products  were  resolved  by  AGE  and 
individual  bands  were  cut  out  and  eluted  by  electro 
elusion  using  dialysis  membrane.  The  puried  DNA 
Fig. 1: a. Colony Morphology of Streptosporangium nondiastaticum TBG75A20; b. Microphograph showing Sporangium; 
c. Primary screening with chitinase activity
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

130
samples were resolved by AGE to check for purity (Fig. 3).
Studies on Fungal Tannase
Tannin acylhydrolase or tannase (E.C 3.1.1.20) is an 
inducible enzyme that catalyses the hydrolysis of ester 
bonds present in hydrolysable tannins and gallic acid 
esters.  Tannase  has  wide  range  of  applications 
especially  in  food,  beverage  and  pharmaceutical 
industries. 
Conrmation  of  Tannase  activity  by  Secondary 
Screening : The strains selected after primary screening 
were conrmed for their activity by secondary screening 
employing submerged culture technique using tannic 
acid  as  the  carbon  source.  The  tannase  assay  was 
determined  based  on  the  formation  of  chromogen 
between gallic acid (released by the action of tannase 
o n   m e t h y l   g a l l a t e   a n d   r h o d a n i n e   ( 2 - t h i o - 4 -
ketothiazolidine).  Five  strains  were  selected  by 
secondary  screening  and  named  as  Asp  TBG  20(a), 
22(d), 24(b), 28 (a) and 30.
Molecular  identication  of  selected  strains:  The 
strains were identied by extracting genomic DNA and 
PCR  amplication  and  sequencing  of  ITS/18S  rDNA 
region. Homology search was performed using BLAST 
search algorithm. Alignment of similar sequences was 
done using CLUSTALW software and the phylogenetic 
tree was constructed using MEGA4 software. 
Improvement of Culture Conditions: Studies on the 
improvement  of  cultural  conditions  required  for  the 
production of tannase under submerged fermentation 
by the Aspergillus isolates were carried out in Czapek 
dox medium containing 1% (w/v) tannic acid, whereby 
the growth, and production of tannase under different 
cultural conditions were monitored at an interval of 24 h 
for 9 days. The results showed that maximal tannase 
th
th
production  was  achieved  on  the  4   and  5   days  of 
incubation. After that the amount of tannase decreased 
considerably  with  increase  in  cultivation  time.  To 
determine  the  effect  of  initial  medium  pH  on  tannase 
production, the medium was adjusted to different pH 
levels  (3-8).  The  results  indicated  that  maximum 
tannase activity was observed at pH 4 & 5. 
Strains  Asp  TBG  20  (a),  28  (a)  and  30  showed 
maximum activity of 9.2, 8.39, 10.6 U/ml respectively at 
o
30 C whereas the other two strains, Asp TBG 22 (d) and 
24  (b)  showed  maximum  activity  of  8.8,  11.75  U/ml 
0
respectively  at  35 C.  The  rapid  growth  of  the  fungal 

culture observed at temperatures between 30 and 35 C 
also  suggested  that  the  fungus  is  mesophilic. 

Therefore,  temperatures  of  40 C  and  above  did  not 
enhance its growth, as the growth of the microorganism 
may  have  adversely  been  affected  by  heat,  while 

temperatures below 30 C may have resulted in freezing 
of  the  protoplasmic  membrane  which  causes 
inactivation of solute transport systems in the cells. The 
variation  in  enzyme  production  with  changes  in 
temperature has also been due to denaturation of some 
of  the  heat  sensitive  biochemical  products  produced 
during fermentation and variation of dissolved oxygen 
tension in the medium with increasing temperatures.
To optimize the concentration of tannic acid required 
for  maximum  enzyme  production  the  culture  media 
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

131
were  supplemented  with  tannic  acid  concentrations 
from  (0.5  to  3%)  and  it  was  found  that  all  the  strains 
showed maximum production at a concentration of 1% 
beyond which there is a decrease in the level of enzyme 
synthesis. To determine whether any additional carbon 
source can increase the level of enzyme production, the 
culture media was supplemented with different carbon 
sources  viz.  Glucose,  fructose,  lactose,  maltose, 
galactose, sucrose etc. Glucose showed an increase in 
enzyme activity. The results showed that small amounts 
of  glucose  can  slightly  increase  the  level  of  enzyme 
production.  But  high  concentration  can  effectively 
decrease the amount of enzyme synthesis and increase 
the biomass content. This is because of the availability 
of  a  readymade  carbon  source  for  their  growth  and 
metabolic activity and there was no need for tannase 
mediated synthesis of glucose.
Thermostable Alpha amylase from Streptomyces 
setonii
The  amylase  family  of  enzymes  is  of  great 
signicance  due  to  its  wide  range  of  potential 
application.    Characterization  and  purication  of 
amylase was the aim of this study. The amylase from 
Streptomyces setonii (TBGA19NRAI) was isolated from 
the forest soil of Neyyar WLS using starch as substrate. 
Optimal  condition  for  amylase  production  was 
standardized  earlier  with  an  optimum  substrate 
concentration (2%), incubation period (48 h) with pH 7. 
The best broth ingredient was found to be valine (0.3%) 
and Ammonium chloride (0.5%).   It was also observed 
that 1% of casein showed maximum activity and 0.025% 
of  CaCl   enhanced  the  production  and  stability  of  α- 
2
amylase  in  the  medium.  The  effect  of  Triton  X-100 
(0.05%) and Mannitol (0.5%) in the medium improved 
the α-amylase yield. The enzyme was produced under 
optimized condition after 48 h of incubation. The crude 
e n z y m e   w a s   s u b j e c t e d   t o   p u r i  c a t i o n   a n d 
characterization.  The  enzyme  was  puried  by 
ammonium  sulphate  precipitation,  dialysis  on 
sephadex G-100 with specic activity of 6.9 units/ml/mg 
protein  with  1.36  fold  purication.  Analyses  of  the 
enzyme  for  molecular  mass  was  carried  out  by  SDS-
PAGE  electrophoresis.  Amylolytic  activity  of  enzyme 
purication and characterization is in progress.
The nucleotide sequences of alpha amylase gene of 
the desired Streptomyces sp. had been retrieved from 
the NCBI in FASTA format. The nucleotide sequences 
so retrieved were subjected to multiple aligment using 
CLUSTAL W and the conserved regions were obtained. 
The  primers  were  designed  using  the  conserved 
regions with primer 3 tool.
 
Primers Designed
Forward Primer   3'-AGTTCGTCTTCCAGCCGG-5'
Reverse Primer3'-CACAGGCCGAGACTCACC-5'
·
Primers designed for the Amy gene of S. griseus
·
Studies to analyse the efciency of S. griseus to 
utilize different starch sources initiated.
Functional  Analysis of Small Heat Shock Proteins 
from Streptomyces spp.
The sHSPs are molecular chaperones which protect 
cells  exposed  to  stress,  by  preventing  apoptosis 
induction and the irreversible aggregation of denaturing 
proteins through oligomer assembly and disassembly. 
Due to their role in stress tolerance, the study of sHSPs 
is  important  in  understanding  molecular,  biochemical 
and  physiological  processes  in  both  normal  and 
Microphotographs of Asp TBG 20 (a) and Asp TBG 22 (d)
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

132
aberrant  cells.  The  thermo-stability,  disaggregation, 
and  proteolysis  inhibition  functions  of  sHSPs  can  be 
harnessed  for  various  applications,  including 
agricultural,  clinical,  nano-biotechnology,  proteomics, 
bio-production,  and  bio-separation.  The  research 
activities carried out under the programme are detailed 
below.
Primers  were  designed  to  effect  the  PCR 
amplication of sHSP genes from the genomic DNA of 
S. albus, S. avermitilis and S. venezuelae using Primer-3 
software.
The lyophilized cultures of S. albus (MTCC 1137) and 
S. venezuelae (MTCC 327) were grown in broth media 
recommended by MTCC. Total   DNA of the organisms 
were  isolated.  Fig.1  shows  the  agarose  gel  (1%) 
electrophoresis of DNA of the organisms. The sHSPs 
from S. albus and S. venezuelae were amplied using  a 
o
gradient PCR (50- 60  C). 
The  amplied  products  were  puried  using  PCR 
product cleaning kit (Quiagen). The PCR product was 
cloned into pGEMT easy vector and transformed  to E. 
coli JM109. Positive clones were selected by antibiotic 
resistance and the plasmid was isolated by alkaline lysis 
method.  The  plasmid  isolated  was  checked  on  1% 
agarose gel (Fig.2) and the correct clones were picked 
up by increase in size.
The  positive  clones  were  further  analysed  by  the 
restriction  digestion  of  plasmid  DNA  by  EcoRI.  The 
positive  clones  releasing  a  500bp  fragment  was 
selected for sequencing.
·
Specic primers for sHSP genes were 
designed.
·
sHSP genes of Streptomyces  albus and S. 
venezuelae were PCR amplied and cloned in 
TA cloning vector. 
Heterologous  expression  and  analysis  of  small 
heat shock proteins
As a universal protective mechanism, all organisms 
undergo a rapid molecular response to adapt to harmful 
environmental  conditions.  During  these  events,  a 
subset of heat shock proteins (HSPs) or stress proteins 
are synthesized. HSPs perform important functions in 
the folding and unfolding or translocation of proteins, as 
well  as  in  the  assembly  and  disassembly  of  protein 
complexes. Small heat shock proteins (sHSPs) have a 
molecular size range from 12 to 43 kDa and a conserved 
region  called  'α–crystalline  domain'  in  the  C-terminal. 
Prevention of thermal inactivation of restriction enzymes 
using  sHSPs  (-crystallin)  was  demonstrated  earlier.  
These  studies  open  a  possibility  of  utilizing  the 
chaperone  activities  of  small  heat  shock  proteins  in 
preserving heat sensitive enzymes. This study aims to 
employ site directed mutagenesis technique to create 
additions or deletions in amino acids of 18HSP and to 
dissect sHSP structure and function at molecular levels. 
This will help to resolve structural elements composed 
of  single  residues,  peptides  and  three-dimensional 
motifs that inuence sHSPs in chaperone activity. The 
active peptides with chaperonic effects can further be 
used as an enzyme stabilizer.
Fig.1. Agarose gel (1%) with PCR products a. S. albus
b. S. venezuelae.
Fig.2. Agarose gel (1%) showing plasmid isolated 
(pGEMT +sHSP gene of  S. albus and S. venezuelae)
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

133
Purication of Recombinant HSP18 protein
Cultivation  of  E.  coli  M15[pREP4]  harbouring 
PQE31/18SHSP(S and P) constructs  was sub-cultured 
and  maintained  in  LB  medium containing  100  mg  /ml 
ampicillin and 50mg/ml kanamycin. Recombinant E coli 
was  grown  in  10ml  LB  broth  containing  100g/ml 
0
ampicillin and 25g/ml kanamycin, at 37 C to an OD of 
600 
0.6 and 5 ml was induced with IPTG (0.4 mM). 
o
After 3-4 h incubation at 37 C cells were harvested 
(12K/2min). 
The histidine tagged protein was puried by nickel 
afnity chromatography (Fig. 3).
Determination of Chaperone Activity
Chaperone activity was assayed by the ability of the 
recombinant Hsp18 to protect amylase   enzymes from 
heat  inactivation.  Amylase  enzyme  (Sigma)  was 
prepared  in  phosphate  buffer  (1  µg/ml).  Different 
concentrations of sHSP18 (0.4, 0.04, 0.02, 0.01, 0.005, 
0.0025 µg/ml) were prepared. 20 µl of amylase enzyme, 
amylase +20 µl of each concentration of sHSP18 were 
mixed  in  an  eppendorf  and  heat  incubated  at  boiling 
temperature  for  30  min.  Starch  agar  (1%starch)  was 
prepared  and  wells  of  6mm  diameter  were  cut  down 
using a cork borer.  20 µl each of   amylase (control, not 
heated), heated fractions, were poured in to the wells 
and incubated for 5 h. Enzymatic activity of amylase was 
detected using iodine solution and measured the  clear 
zone diameter. The result showed that 0.4 µg and 0.04 
µg  of  sHSP18  can  protect  the  heat  inactivation  of  
amylase enzyme (Fig. 4).
·
Recombinant sHSP18 protein was puried by Ni 
afnity gel 
·
Chaperonic activity of the M leprae s HSP18 was 
demonstrated by heat inactivation of  amylase 
enzyme.
Genomic and Proteomic Studies on Small Heat 
Shock Proteins from Artemia spp.

Small  heat  shock  proteins  (sHSPs)  are  ATP-
independent  molecular  chaperones  that  bind  to 
denaturing  proteins  and  thereby  protect  cells  from 
damage  due  to  irreversible  protein  aggregation.  The 
thermo-stability,  disaggregation,  and  proteolysis 
inhibition  functions  of  sHSPs  can  be  harnessed  for 
various applications. 
Samples studied
Artemia  parthenogenetica  was  collected  from  the 
Thamaraikulam  salterns  (8°06'N  77°29'E).They  were 
grown  in  natural  sea  water  of  salinity  35  ppt  and 
incubated  at  room  temperature.  It  was  fed  with  the 
unicellular  brown  alga  Isochrysis  galbana.  Cysts 
produced in the culture was isolated, washed and stored 
in deep freezer. Artemia franciscana and Artemia salina 
cysts were obtained from Dalhousie University, Canada 
and CMFRI, Vizhinjam respectively. 
Isolation of RNA and cDNA preparation
RNA was isolated from the 3 Artemia species using 
100 mg cyst samples. Cysts were homogenized in 1 mL 
TRIzol reagent using micropestle at room temperature 
and  then  passed  through  a 
2.5mL syringe. Homogenized 
samples  were  incubated  at 
room  temperature  for  5  min, 
centrifuged  and  supernatant 
collected. 0.2 mL chloroform 
was  added,  followed  by 
v i g o r o u s   s h a k i n g   a n d 
i n c u b a t i o n   a t   r o o m 
temperature  for  3  min.  The 
mixture  was  centrifuged  and 
RNA  was  precipitated  from 
the aqueous phase by adding 
0.5mL  100%  ethanol  (ice 
cold),  incubated  at  room 
temperature  for  10  min  and 
centrifuged at 14000 g for 10 
min.  Supernatants  were 
d i s c a r d e d   a n d   p e l l e t s 
washed  by  vortex  mixing  in 
70%  ethanol  (ice  cold), 
collected by centrifugation at 
10000 g for 10 min, air-dried 
Fig. 4. Chaperone activity of sHSP18. 
a. Heated amylase (20ul) + 0.4 µg of sHSP18; 
b. Heated amylase (20ul) + 0.04 µg of sHSP18; 
c. Heated amylase (20ul) + 0.2 µg of sHSP18; 
d. Control, 20µl of unheated 
Fig. 3. Ni Afnity Purication of 
sHSP18. Line 1- marker; 
2 - Uninduced cell lysate;
3 - Induced cell lysate;
4 - puried protein.
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

134
for  20  min,  dissolved  in  50  µl  diethyl  pyrocarbonate-
treated water and stored at -20 °C. cDNA was generated 
®
using  SuperScript   III  Reverse  Transcriptase  kit  from 
Invitrogen  using  random  hexamers  and  oligo(dT) 
primers. 
Amplication of COI gene and p26 gene
COI  gene  is  widely  used  as  a  DNA  barcode  to 
identify  animal  species  because  its  mutation  rate  is 
often fast enough to distinguish closely related species 
and  also  because  its  sequence  is  conserved  among 
conspecics.as The Cytochrome c oxidase I gene was 
amplied  from  cDNA  using  the  primers  COIF  5`-
ATTCTACGAATCACAAGGATATTGG-3`  and  COI5`-
T A C A C T T C A G G A T G G C C A A A A A A T C A - 3 ` . 
EmeraldAmp®  (Takara)  mix  was  used  for  PCR 
amplication with the following temperature proles and 
conditions: 1 min at 98 °C, 30 cycles of 10 s at 98 °C, 30 s 
at 50-58  °C gradient, 1 min 30 s at 72 °C and a nal 
extension of 7 min at 72 °C. Total reaction volumes of 25 
µl consisted of 0.5 µl template DNA, 12.5 µl Emerald 
mix, 1 µl of each primer (10 µM). 
The  small  heat  shock  protein  p26  gene  was 
amplied from cDNA using EmeraldAmp® Max using 
similar conditions. The primers used were:
COI gene and p26 gene amplication products from 
the three Artemia species will be sequenced at RGCB.
RNA was isolated from three Artemia species and 
cDNA was prepared (Fig. 5). COI gene was amplied 
from cDNA of all three Artemia species, which will be 
sent to RGCB for sequencing for conrming the species 
(Fig. 6). p26 gene was amplied from cDNA of the 3 
Artemia species using the primers P26AF, P26AR and 
P26BF, P26BR (Fig. 7). 
Studies  on  bacterial  cell  division  protein  (FtsZ) 
inhibitors from wild medicinal and aromatic plants
The  problem  of  antibiotic  resistance  is  worsening 
worldwide  because  of  the  overuse  of  existing 
antibiotics. In order to overcome the crisis of antibiotic 
resistance,  there  is  an  urgent  need  for  alternative 
antibacterial  agents  that  have  novel  mechanisms  of 
action.  Filamentous  temperature  sensitive  mutant  Z 
(FtsZ),  is a tubulin homologue,  an essential protein for 
cell-division  in  prokaryotic  organisms.    FtsZ  is  an 
unexploited and attractive target for antibacterial drug 
discovery because of its widespread conservation in the 
bacterial kingdom, its absence in the mitochondria of 
higher  eukaryotes  and  its  known  biochemical  activity 
Fig. 5. 1% AGE showing 1. RNA; 2. cDNA from A. franciscana;
3. RNA; 4. cDNA from A. salina  and 5. RNA, 6. cDNA from  
A. parthenogenetica
Fig.7: 1% AGE of p26 gene 
1. from A. franciscana; 
2. from A. parthenogenetica
3. from A. salina; 4. 100bp marker
2
3
4
Fig.6. 1% AGE of COI gene 
amplication. M. 100 bp Marker; 
1 & 2 COI from 
A. franciscana cDNA; 
3 & 4 COI from 
A. parthenogenetica cDNA; 
5 & 6 - COI from A. salina cDNA
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

135
and molecular structure
FtsZ polymerizes to form a Z-ring at the mid cell that 
orchestrates bacterial cell division. FtsZ is shown to be 
essential  for  bacterial  cell  division  and  viability.  Since 
inhibition of function of FtsZ is lethal to bacteria, both 
GTP-dependent polymerization and enzymatic activities 
of FtsZ have been targeted for the identication of new 
antibacterial  agents.  Present  study  aims  at  the 
screening, isolation and characterization of novel active 
therapeutic  'lead  compounds'  with  anti-bacterial 
properties,  targeting  the  inhibition  of  bacterial  FtsZ 
polymerization.  The project intends to screen selected 
medicinal and aromatic plants of the Western Ghats of 
Kerala  region  to  isolate  potential  FtsZ  inhibitory 
molecules.
Antimicrobial  screening  of  different  plant  extracts 
and  essential  oils  was  done.  Methanol  extract  of  13 
different Garcinia spp. were screened for antimicrobial 
activity. Methanol and hexane extracts of Cinnamomum 
were  screened  by  Disc  diffusion  method  for 
antibacterial  activity.  Essential  oils  of  four  different 
Cinnamomum  spp.  screened  for  antimicrobial  activity 
was  found  to  possess  antimicrobial  activity.  Seven 
different  Euphorbia  species  methanol  and  hexane 
extracts  were  screened  for  antimicrobial  activity. 
Malachite Green Assay was done to evaluate ability of 
natural compounds to interfere with GTPase activity of 
FtsZ protein. 
·
Standardized  enzyme  coupled  FtsZ  inhibition 
assay.
·
Essential  oil  of  Cinnamomum  verum  and 
methanolic  extracts  of  Euphorbia  pteroneuro, 
Euphorbia tirucalli, Euphorbia antiquorum showed 
FtsZ GTPase interfering activity. 
Cloning,  expression  and  purication  of  small  Heat 
Shock Proteins from Streptomyces spp.

S t r e p t o m y c e t e s   a r e   a m o n g   t h e   m o s t 
numerous and ubiquitous soil bacteria, where they play 
a  central  role  in  carbon  recycling.  Streptomycetes 
belongs to the order Actinomycetales, which includes a 
large  number  of  antibiotic-producing  species.  As  a 
universal protective mechanism, all organisms undergo 
a  rapid  molecular  response  to  adapt  to  harmful 
environmental  conditions.  During  these  events,  a 
subset of heat shock proteins (HSPs) or stress proteins 
are synthesized. HSP performs important functions in 
the folding and unfolding or translocation of proteins, as 
well  as  in  the  assembly  and  disassembly  of  protein 
complexes. Small heat shock proteins (sHSPs) have a 
molecular size range from 12 to 43 kDa and a conserved 
region called 'α–crystallin domain' in the C-terminal half 
of these proteins. This study aims at cloning, expression 
and  purication  of  small  Heat  Shock  Proteins  from 
Streptomyces spp 
Isolation
Soil samples were collected from Silent Valley and 
Bonaccord  forests.  Actinomycetes  were  isolated  by 
standard  dilution  method  using  Glucose  asparagine 
agar  medium.  A  total  of  20  Actinomycetes  were 
0
obtained  and  maintained  at  4 C  by  periodical  sub-
culturing.
Fig. 8. Antimicrobial activity of Cinnamomum malabartum 
against Bacillus subtilis
Fig. 9. Antimicrobial activity of Cinnamomum verum against E.coli
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

136
Taxonomic studies

Gross morphological observations were made 
by  using  cultures  grown  for  14  days  at  28°C  on  the 
standard  media  suggested  by  the  International 
Streptomyces  Project  (ISP).  Micromorphology  and 
sporulation  were  determined  by  phase  contrast 
microscopy (Nikon Optiphot-II). Standard physiological 
0
tests  were  performed  after  growth  at  30 C  for  the 
recommended  incubation  periods.  The  tests  to 
determine  utilization  of  carbohydrates  as  the  sole 
carbon source for growth were performed. All carbon 
sources for carbon-utilization tests were ether sterilized 
and tested at the concentrations of ISP standard. 
Molecular Taxonomy
Total DNA preparation from the isolates were carried 
out  according  to  Murray&  Thompson  (1980).  PCR 
amplication  of  approximately  1,500  bp  of  16S 
ribosomal DNA (rDNA) of the isolates were  performed 
u s i n g   t h e   e u b a c t e r i a l   p r i m e r s   8 - 2 8 F,   5 ' 
AGAGTTTGATCCTGGCTCAG  3'  and  1495R  5'-
CTACGGCTACCTTGTTACGA -3'. Approximately 30 µg 
genomic template DNA was used with 10 pmol of each 
primer per 25 µl reaction volume. Emerald AMPG PCR 
mastermix (Takara) was used for the PCR following hot 
start PCR protocols. The PCR products were analysed 
on 1% agarose gel electrophoresis. 
The primer 8-27F and 1495 R was used for 16s rDNA 
gene sequencing. The sequencing of the PCR products 
were  done  in  ABI-3130  Genetic  Analyzer  (ABI,  USA) 
according to manufacturer's specications. 
Homology  search  of  the  16s  rDNA 
sequence  obtained  was  performed  using 
BLAST  search  algorithm.  Alignment  of 
similar  sequences  was  done  using 
CLUSTAL X software and the phylogenetic 
®
tree  was  constructed  using  TREECON  
software.  Distance  estimation  was  done 
following  Jukes  and  Cantor  (1969).    The 
stability of relationship was assessed from 
bootstrap analysis of the neighbour-joining 
data based on 1000 resampling.
Twenty  isolates  were  analysed  for  its 
m o r p h o l o g i c a l ,   p h y s i o l o g i c a l   a n d 
biochemical  properties  following  the 
International  Streptomyces  Project  (ISP) 
protocols.  Based  on  the  morphological 
characters  and  16s  rDNA  sequence 
homology,  all  strains  were  identied  as 
Streptomyces spp. Among these, ve were 
identied up to species level.
List of Isolates Identied
  1.  Streptomyces californicus (TBG-201)
  2.  Streptomyces violacens (TBG-I5II)
  3.  Streptomyces exfoliates (TBG-ALA 4-7) 
  4.  Streptomyces transhiensis (TBG-ALA 8III)  
  5.  Streptomyces samsoni (TBG-TCAXA)
  6.  Streptomyces sp. (TBG-ALA 8II)
  7.  Streptomyces sp. (TBG-SH10)
  8.  Streptomyces sp. (TBG-S13A5)
  9.  Streptomyces sp. (TBG-N1)
 10.  Streptomyces sp. (TBG-N2)
 
   
Streptomyces sp. (TBG-N3)
 11.  Streptomyces sp. (TBG-N4)
 12.  Streptomyces sp. (TBG-N5)
 13.  Streptomyces sp. (TBG-N6)
 14.  Streptomyces sp. (TBG-N7)
 15.  Streptomyces sp. (TBG-N8)
 16.  Streptomyces sp. (TBG-N9)
 17.  Streptomyces sp. (TBG-N10)
 18.  Streptomyces sp. (TBG-N-11)
 19.  Streptomyces sp. (TBG-N12)
PCR amplication of small HSP gene
Two  sets  of  degenerative  primers  were  designed 
based on the conserved regions of available small heat 
shock genes of Streptomyces spp.  A gradient PCR was 
carried  out  to  amplify  the  small  heat  shock  protein 
encoding gene using different combination of primers. 
Fig. 11 A&B: Streptomyces samsoni (TBG-TCAXA), Colony morphology and
 Microphotograph showing aerial mycelia and spore chains.
Fig. 10A&B: Streptomyces exfoliates (TBG-ALA 4-7), Colony morphology and 
microphotograph showing aerial mycelia and spore chains.
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

137
Approximately 30ng genomic template DNA was used 
with 10pmol of each primer per 25 µl reaction volume. 
Emarald AMPG PCR mastermix (Takara) was used for 
the  PCR  following  hot  start  PCR  protocols.  The  PCR 
products  were  analysed  on  1%  agarose  gel 
electrophoresis.
·
5 Streptomyces isolates were identied at species 
level and 15 at genus level.
·
Further taxonomic studies are in progress.
·
Degenerative  primers  designed  based  on 
conserved regions in known Streptomyces sHSP 
genes
·
sHSP  genes  of  few  Streptomyces  species  were 
PCR amplied using degenerative primers.
Development  of  a  rhizosecretion  system  for 
recombinant  protein  expression  in  Lemna  gibba.,  L 
using the candidate molecule, hCAP-18.

Plants  are  used  extensively  as  the  bio-
manufacturing  platforms  due  to  the  characteristic 
features  they  possess.  Rhizosecretion  is  the  targeted 
secretion  of  molecules  through  the  root  system  of 
plants. The rhizosecretion phenomenon is used in the 
hairy root cultures of Nicotiana tabacum, and has the 
potential to be exploited in other plant species also. The 
hCAP-18  is  a  mammalian  protein,  has  roles  in  the 
defence  system  in  humans.  It  has  anti-microbial  and 
ani-larvicidal properties. 
Selection of signal peptides: 
Signal  peptides  are  the  small  polypeptides,  which 
target the movement proteins to different parts of the 
cell.  They  are  usually  N-  or  C-terminally  placed.  The 
most  crucial  decision  in  this  project  was  the  proper 
selection  of  the  signal  peptide.  10  signal  peptides, 
reported in literature were analyzed in detail and two of 
them  (Calreticulin  (Cal)  and  Immunoglobulin  K  (IgK) 
were selected for the study based on their effectiveness 
reported in literature. The sequences of amino acids for 
the signals selected are;
1 Careticulin :  ATGCTGCTATCCGTGCCGTTGCTGCT
 
  CGGCCTCCTCGGCCTGGCCGTCGCC
2 IgK 
:  ATGGAGACAGACACACTCCTGCTATG
 
  GGTA CTGCTGCTCTGGGTTCCAGGTT
 
  CCACTGGT    
Designing  of  oligos  corresponding  to  the  signal 
peptide and hCAP-18: 
In order to construct the plant expression vector, the 
nucleotide  sequence  of  the  signal  peptide  and  the 
human  protein  (hCAP-18)  were  synthesized  using 
automated  oligo  synthesizer.  There  were  a  total  of  6 
oligos  for  the  hCAP-18  and  4  each  for  the  signal 
peptides.
Annealing of oligos and amplication of signal 
peptide+hCAP-18 using specic primers: 
The  oligos  designed  for  the  signal  peptide  and 
hCAP-18 was annealed using the conventional protocol 
in  the  annealing  buffer.  The  oligos  were  designed  in 
such a way that 4 to 5 nucleotides overlap the sequential 
strands in the complementary strand.   The annealing 
was done in the order of 
1.  Signal peptide (2 double stranded oligos)
2.  hCAP-18 (3 double stranded oligos)
The oligos of signal peptide and the oligos of hCAP-
18 were ligated separately and a nal ligation was set 
with signal peptide and hCAP-18 (Fig.13)
The ligated oligos were used in the PCR to amplify 
the  signal+hCAP-18  fragment  with  designed  oligos 
favouring the release and cloning of the fragment in the 
plant  expression  vectors  like  pCAMBIA  and  pGA643. 
The sequences of the primers designed are;
pCAM-F: 5'- TTAGATCTATGCTGCTATCCGTGCC- 3'
Fig. 12a & b. 1% AGE showing PCR amplication with f1/rp (a) and with f2/rp (b)
JNTBGRI Annul Report 2012-’13 & 2013-’14
Jawaharlal Nehru Tropical Botanic Garden and Research Institute 

138
pCAM-R:5'- AACACGTGCTAGGACTCTGTCC- 3'
pGA-F:5'- TTAAGCTTATGCTGCTATCCGTGCC- 3'
pGA-R:5'- AAAGATCTCTAGGACTCTGTCCTG- 3'
Cloning  of  signal+hCAP-18  PCR  amplicon  in 
pXcmkn12 TA-cloning vector: 
The amplied signal+hCAP-18 was cloned in the TA-
cloning vector pXcmkn12. For this, the amplicon was 
ligated  to  XcmI  digested  (T-termini)  pXcmkn12  vector 
and E. coli DH5 alpha cells were transformed with the 
ligation mixture.
The  colonies  resistant  to  the  antibiotic  were 
inoculated for plasmid preparation in LB. Plasmid was 
prepared  using  the  conventional  alkali-lysis  method 
(Fig.14). The integration of 158 and 162bp IgK+hCAP-
18  and  Cal+hCAP-18  were  conrmed  by  restriction 
analysis (Fig.15)
Release  of  signal+hCP-18  from  pXcmkn12  and 
cloning in Pcambia : In order to clone the signal+hCAP-
18  piece  of  cDNA,  the  pXcmkn12-  signal+hCAP-18 
construct was extracted from the E. coli cells and the 
signal+hCAP-18  fragment  was  released  using  the 
specic  restriction  sites  incorporated  in  the  primers, 
corresponding  to  different  plant  expression  vectors. 
The  cloning  of  signal+hCAP-18  in  to  pGA643  and 
pCAMBIA 2301 is in progress.
1   ...   5   6   7   8   9   10   11   12   ...   17


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azkurs.org 2016
rəhbərliyinə müraciət

    Ana səhifə