From mutations to disease mechanism in rett syndrome, breast cancer, and congenital hypothyroidism



Yüklə 4,8 Kb.
Pdf görüntüsü
səhifə6/13
tarix05.05.2017
ölçüsü4,8 Kb.
1   2   3   4   5   6   7   8   9   ...   13

1.4.5.  Thyroid Development and TTF-2 
 
The  mature  mammalian  thyroid  gland  evolves  from  two  distinct  embryologic 
structures,  the  thyroid  diverticulum,  an  endodermal  component  that  gives  rise  to  thyroid 
follicular cells, and the neuroectodermal ultimobranchial bodies that differentiate into the 
parafollicular  calcitonin-producing  C  cells.  Thyroid  follicular  cells  originate  by 
invagination of pharyngeal endoderm beginning at E8–8.5 of mouse development (Ericson 
and  Frederiksson,  1990).  The  thyroid  primordium  migrates  downward  to  reach  its  final 
destination  in  front  of  the  trachea  at  E13–14.  It  is  only  at  E15,  after  completion  of  the 
migration process, that thyroid follicular cells differentiate, as measured by expression of 
several  thyroid-specific  genes  (Tg,  TPO  and  TSHr)  (Lazzaro  et  al.,  1991).  Two 
transcription  factors,  TTF-1  and  Pax-8,  have  been  proposed  to  be  necessary  for  thyroid 
differentiation (Damante and Di Lauro, 1994). These proteins are present in the thyroid at 
late  stage  at  E8.5,  suggesting  that  an  additional,  essential  event(s)  must  occur  to  trigger 
differentiation of thyroid cells at E13–14 (Lazzaro et al., 1991). TTF-2 expression is turned 
off exactly  between  E13  and  E15  in  the  developing  thyroid.  The correlation  between  the 
onset of thyroglobulin and thyroperoxidase gene expression and the disappearance of TTF-
2  mRNA  suggests  that  in  the  embryo  the  role  of  TTF-2  is  to  block  the  activation  of 
thyroid-specific  gene  expression  by  TTF-1  and  Pax-8.  It  has  been  proposed  that  thyroid 
cell precursors enter into a determined state at E8.5, which is characterized, and possibly 
induced,  by  the  presence  of  TTF-1  and  Pax-8.  During  the  next  5  days,  thyroid  cell 
precursors  undergo  a  long  migration,  at  the  end  of  which  they  will  express  their  full-
differentiated  phenotype.  The  presence  of  TTF-2  in  the  migrating  thyroid  cell  precursors 
would  prevent  precocious  expression  of  genes  that  might  have  an  adverse  effect  on 
migration, for example because of changes in the adhesive properties of the cells (Zannini 
et al
., 1997). In adult thyroid tissue TTF-2 expression is restored. It also shows a transient 
expression pattern in the developing pituitary. When Rathke’s pouch is completed at E12-
12.5, TTF-2 is undetectable in pituitary cells (Hermesz et al., 1996).  
 
TTF-2 is expressed in two glands, the thyroid and the pituitary, which are part of a 
regulatory circuit responsible for homeostatic control of thyroid hormone production. The 
hypothalamus  is  also  part  of  this  circuit,  where  TTF-1,  another  transcription  factor  of 
relevance in thyroid cell function and differentiation, is expressed (Kimura et al., 1996). It 

 
 
43 
is inviting to think that recruitment of the same regulatory molecules in functionally related 
organs  in  the  thyroid–pituitary–hypothalamic  axis  is  advantageous  to  coordinate 
development and function. 
 
TTF-2  has  a  dual  function  in  the  development  of  the  thyroid  gland  (Zannini  et  al., 
1997).  In  the  mouse,  TTF-2  shows  transient  expression  during  the  migration  of  thyroid 
precursor cells from the invagination of the pharyngeal endoderm to the final destination in 
front  of  the  trachea.  During  this  period,  TTF-2  represses  transcriptional  activation  of  the 
thyroglobulin  and  thyroperoxidase  promoters  by  TTF-1  and  PAX8,  respectively. 
Subsequently, TTF-2 expression is turned off; however, is restored in adult thyroid tissue. 
In  the  adult  thyroid,  TTF-2  functions  as  a  transcriptional  activator  of  thyroglobulin 
(Sinclair  et  al.,  1990)  and  thyroperoxidase  (Francis-Lang  et  al.,  1992;  Aza-Blanc  et  al., 
1993). 
 
1.4.6.  TTF-2 Gene Mutations 
 
Two  missense  mutations  (p.A65V  and  p.S57N)  of  human  TTF-2  gene  have  been 
reported  in  two  families  with  CH.  In  a  Welsh  family,  two  male  siblings  with  thyroid 
agenesis,  cleft  palate,  choanal  atresia  and  bifid  epiglottis  together  with  spiky  hair  were 
homozygous for a missense mutation (p.A65V) within the forkhead DNA binding domain. 
Functional  studies  indicated  that  the  p.A65V  mutation  is  highly  deleterious,  with  the 
mutant protein exhibiting a complete lack of DNA binding and transcriptional activation. 
In neither case thyroid tissue was detected by 
123
I scanning and ultrasonography (Clifton-
Bligh et al., 1998). In the second family, a homozygous p.S57N missense mutation within 
the  forkhead  domain  was  reported  in  two  probands  presented  with  CH.  Both  siblings 
exhibited  cleft  palate,  and  the  other  cervical  midline  defects  (choanal  atresia,  bifid 
epiglottis) were absent. When compared directly in functional studies, the p.S57N mutation 
is  less  deleterious  than  the  p.A65V  mutation,  preserving  some  DNA  binding  and 
transcriptional activity. Although p.S57N mutant protein retains 75 per cent of the maximal 
transcriptional  activity,  thyroid  tissue  was  absent  in  both  siblings.  Unlike  the  cases 
described  previously,  these  patients  had  an  incomplete  clinical  phenotype,  which  may 
indicate partial preservation of TTF-2 function in vivo (Castanet et al., 2002). 
 

 
 
44 
1.4.7.  Plasma Cholinesterase Deficiency 
 
Patients with CH are candidates for multiple operations due to midline defects (cleft 
palate  and  choanal  atresia)  and  their  response  to  administration  of  muscle  relaxants  is 
crucial.  Several  cases  with  different  disease  phenotype  showing  the  prolonged 
neuromuscular block (paralysis) have been reported following the administration of muscle 
relaxants  such  as  mivacurium  (Kaiser  et  al.,  1995;  Chung  et  al.,  2002).  Mivacurium is  a 
short  acting  non-depolarising  neuromuscular  blocking  agent  (Kaiser  et  al.,  1995). 
Deficiency  or  abnormality  of  plasma  cholinesterase  (also  called  pseudocholinesterase–
PChE,  butyrylcholinesterase–BChE)  may  cause  prolonged  duration  of  action  of 
mivacurium (
Barta et al., 2001
). Up to date, more than 20 genetic variants of BChE have 
been  described  and  p.Asp70Gly  (A-variant)  and  Ala539Thr  (K-variant)  are  the  most 
common ones responsible for reduced activity of Butyrylcholinesterase (La Du, 1993). 
 
 

 
45 
2.  AIM OF THE STUDY 
 
 
In  the  context  of  this  study,  the  aim  was  to  investigate  the  genetic  mechanisms 
responsible  for  Rett  Syndrome  (RTT),  Breast  Carcinogenesis,  and  Congenital 
Hypothyroidism (CH). 
  
To  provide  further  delineation  of  MECP2  mutations  in  RTT  patients,  we  have 
investigated the mutation profile of the entire coding region of the MECP2 gene and XCI 
pattern  in  a  cohort  of  71  patients  with  classical  or  atypical  RTT.  The  analyses  in  RTT 
patients were extended: 
 
•  to establish quantitative Real Time PCR and quantitative fluorescent multiplex PCR 
assays to detect the MECP2 exon rearrangements in mutation negative patients,  
•  to  evaluate  the  impact  of  the  use  of  stringent  clinical  criteria  on  MECP2  mutation 
detection rate,  
•  to establish XCI analysis using two different reference genes,  
•  to evaluate the contribution of XCI to RTT clinical phenotype,  
•  to perform genotype/phenotype correlation based on comparison of severity score of 
patients with the type and location of the mutation and the XCI pattern. 
•  to develop a
 
rapid and efficient MECP2 mutation screening strategy to be used as a 
preliminary  step  for  genetic  diagnosis  of  RTT.
 
We  aimed  to  design  a  simpler 
multiplex  ARMS-PCR  strategy  that  allows  identification
 
of  seven  mutations 
accounting for up to two thirds of pathogenic MECP2 mutations.  
•  to analyse the effect of DNA concentration on reliability and reproducibility of Real 
Time PCR analysis for identification of MECP2 exon rearrangments.  
 
Aberrant methylation of CpG-rich sites (CpG islands) was identified as an epigenetic 
mechanism for the transcriptional silencing of repair genes in different types of cancer. In 
this  study,  the  methylation  status  of  5’  flanking  regions  (including  the  CpG  islands  and 
putative promoter sequence) of hHR23A and hHR23B genes were investigated in primary 
breast  tumor,  tumor  adjacent  tissues,  and  normal  breast  tissues.  Since  the  methylation 
status of these genes was not investigated before, we aimed; 

 
46 
•  to  characterize  the  CpG  islands  and  the  putative  promoter  region  in  the  5'  flanking 
region of the hHR23 genes using web-based analysis,  
•  to  design  primer  sequences  to  investigate  the  methylation  status  of  CpG  di-
nucleotides, 
•  to determine the methylation status of the putative promoter region of hHR23 genes 
in archival formalin-fixed, paraffin-embedded breast tumor and normal tissues. 
 
The  genetic  mechanisms  leading  to  congenital  hypothyroidism  and  prolonged 
paralysis  after  mivacurium  in  a  patient  with  Bamforth  Syndrome  were  investigated.  For 
this purpose;  
 
•  The  patient  was  screened  for  the  presence  of  mutations  within  the  TTF2  gene 
responsible of hypothyroidism. The effect of the identified mutation on DNA binding 
ability of the TTF2 protein was tested based on a collaborative study. 
•  Since  our  CH  patient  was  the  first  case  with  Bamforth  Syndrome  showing  plasma 
cholinesterase deficiency, the patient DNA sample was investigated for the presence 
of  BChE  variants  responsible  for  prolonged  neuromuscular  block  (paralysis)  after 
administration of mivacurium as a muscle relaxant. 

 
47 
3.  MATERIALS 
 
 
3.1.  Subjects and Samples 
 
Peripheral  blood  samples  of  patients  with  Rett  Syndrome  were  provided  with  an 
informed  consent  by  Istanbul  University  (Department  of  Neurology,  Division  of  Child 
Neurology),  Marmara  University  Hospital  (Department  of  Pediatrics,  Division  of  Child 
Neurology),  Health  Ministry  Tepecik  Education  Hospital  (Child  Health  and  Diseases 
Clinics), and other centers. 
 
The patient with Congenital Hypothyroidism was referred from Kocaeli University, 
Faculty of Medicine, Department of Pediatrics.  
 
Archival  formalin-fixed,  paraffin-embedded  tissues  were  kindly  provided  by 
Marmara  University  Hospital  (Department  of  Pathology)  and  Nişantaşı  Pathology 
Laboratories (Istanbul, Turkey).  
 
3.2.  Chemicals 
 
All  solid  and  liquid  chemicals  used  in  this  study  were  purchased  from  Merck 
(Germany), Sigma (USA), Riedel de-Häen (Germany), and Carlo Erba (Germany), unless 
stated otherwise in the text. 
 
3.3.  Fine Chemicals 
 
3.3.1.  Enzymes 
 
Taq
 DNA Polymerases were purchased from Fermentas (MBI Fermentas, Lithuania). 
The restriction enzymes were purchased from Promega (USA), Fermentas (Lithuania), and 
New England Biolabs (England).  
 
 

 
48 
3.3.2.  Oligonucleotide Primers 
 
The  primers  used  in  the  framework  of  this  thesis  were  synthesized  by  Integrated 
DNA Technologies (USA), Alpha DNA (Canada), or Iontek (Istanbul). The sequence and 
PCR conditions for the primers used throughout the thesis are given in Table 3.1 through 
Table 3.7.  
 
Table 3.1.  Sequence of the primers used for exon amplification of the MECP2 gene. 
Ekxon 
Primers (5’
 3’) 
PCR 
Product 
Length (bp) 
Annealing 
Temp. 
(°°°°C) 
Exon 
Rettex1F: ggacaggaaatctcgccaat 
Rettex1R: cacggcggtcccactc 
340  
57  
Exon 2 
Rett1F:  tttctttgttttaggctcca 
Rett1R: ggccaaaccaggacatatac 
190  
57  
Rett2.3F: gtgatacttacatacttgtt 
Rett2.3R: ggctcagcagagtggtgggc 
172  
56  
Exon 3 
Rett 2.1F: gagcccgtgcagccatcagc 
Rett2.2R: ctgtagagataggagttgct 
270  
62  
Rett 3AF: tgtgtctttctgtttgtccc 
Rett 3AR: gatttgggcttcttaggtgg 
182  
57  
Rett 3BF: cctcccggcgagagcagaaa 
Rett 3BR: tgacctgggtggatgtggtg 
240  
57  
Rett 3CF: tgccttttcaaacttcgcca 
Rett 3CR: tgaggaggcgctgctgctgc 
410  
57  
Rett 3CF: tgccttttcaaacttcgcca 
Rett 3MR: tggcctgagggtcggcctcagctttgc 
120  
58  
Rett 3DF: gcagcagcagcgcctcctca 
Rett 3DR: tggcaaccgcgggctgaggca 
244  
60  
Exon 4 
Rett 3EF: tgccccaaggagccagctaa 
Rett 3ER: gctttgcaatccgctccgtg 
200  
58  
 
 
 

 
49 
Table 3.2.  Primers used in X chromosome inactivation analysis. 
Gene 
Primers (5’
 3’) 
PCR Product 
Length (bp)
 
Annealing 
Temp. (°°°°C)
 
AR 
Xinact F: gctgtgaaggttgctgttcctcat 
Xinact R: tccagaatctgttccagagcgtgc 
280 
65 
ZNF261 
Xinact2 F: atgctaaggaccatccagga 
Xinact2 R: ggagttttcctccctcacca  
280 
58 
 
 
Table 3.3.  Sequences and PCR conditions for the primers used in quantitative Real Time 
PCR analysis.  
Gene 
Primers (5’
 3’) 
PCR Product 
Length (bp)
 
Annealing 
Temp. (°°°°C)
 
Rett_exon2F:  tttctttgttttaggctcca 
Rett_exon2R: ggccaaaccaggacatatac 
190 
58 
Rett_exon3F: gtgatacttacatacttgtt 
Rett_exon3R: ggctcagcagagtggtgggc 
172 
58 
MECP2 
Rett_exon4F: tgtgtctttctgtttgtccc 
Rett_exon4R: gatttgggcttcttaggtgg 
182 
58 
NDRG1 
NDRG1_exon7F: aggctcccgtcactctg 
NDRG1_exon7R: gtcttccttcatcttaaaatg 
175 
58 
PRX 
PRX_exon6F: cgtgcaagtgggcagaacta 
PRX_exon6R: tgacaagacagagggcaagg 
383 
58 
 
 
Table 3.4.  Sequence of the primers used in quantitative fluoresent multiplex PCR analysis.  
Gene 
Primers (5’
 3’) 
PCR Product 
Length (bp)
 
Annealing 
Temp. (°°°°C)
 
MECP2 
MeCP2-3Fam: gagcccgtgcagccatcagc 
MeCp2-3R: cgtgtccagccttcaggcag 
180 
58 
PRNP 
PRNP-2Fam: actgcgtcaatatcacaatc  
PRNP-2R: tccccactatcaggaagatga 
227 
58 
 

 
50 
Table 3.5.  Sequence of the primers used in methylation analyses of the putative promoter 
region of hHR23A and hHR23B genes. 
 
Gene 
Primers (5’
 3’) 
PCR Product 
Length (bp)
 
Annealing 
Temp. (°°°°C)
 
Rad23A-CF: ttagtataggtatataaaaattttgttaaa 
Rad23A-CR: aatcttaaaaatctactactacaacatttt 
433 
50 
Rad23A-CF2: gtgagagtggggatattagagttattttgt 
Rad23A-CR: aatcttaaaaatctactactacaacatttt 
390 
54 
Rad23A-F1: gaagaaatataaatgtttgtaattagtatagg 
Rad23A-R1: ttaaaattctaacctccccgccc 
555 
50 
hHR23A 
Rad23A-CF2: gtgagagtggggatattagagttattttgt 
Rad23A-R1: ttaaaattctaacctccccgccc 
480 
54 
Rad23B-CF: tttttgttttagggttttgtatttat 
Rad23B-CR: tcaccaaaacataccccctc 
370 
50 
Rad23B-CF2: tttattttgttgggtttttatg 
Rad23B-CR: tcaccaaaacataccccctc 
349 
54 
hHR23B 
Rad23B-CN: ttgtgtaattttggtagttgggt 
Rad23B-CR: tcaccaaaacataccccctc 
304 
54 
 
 
Table 3.6.  Sequence of the primers used for exon amplification of the TTF2 gene. 
 
Exon 
Primers (5’
 3’) 
PCR Product 
Length (bp)
 
Annealing 
Temp. (°°°°C)
 
TTF2A: agcctgggccgctgggctctccg 
TTF2D: ttgtggcggatgctgttctgc 
463 
58 
Exon 1 
TTF2C: cggcatctacaagttcatcac 
TTF2E: cagcagcggcaaagatcg 
671 
53 
 
 
 
 

 
51 
Table 3.7.  Sequence of the primers used for exon amplification of the BChE gene. 
Variant 
Primers (5’
 3’) 
PCR Product 
Length (bp)
 
Annealing 
Temp. (°°°°C)
 
A-Variant 
M-6: acatactgaagatgacatcata    
M115: tgttccagtttgaaaaccacca 
373 
52 
K-Variant 
AP5: cgaaattatttttcagttaatgaaacagataaaaattt  
C539: tgctttccactcccattcag 
103 
60 
 
 
3.3.3.  DNA Size Marker 
 
Size marker used in this study was 100-bp DNA ladder between 100 and 1000 bp 
(MBI Fermentas, Lithuania).  
 
3.4.  Kits 
 
QIAquick  PCR  Purification  Kit  was  purchased  from  Qiagen  (Germany).  SYBR 
Premix  Ex  Taq  was  purchased  from  TaKaRa  (Japan).
 
Methylamp
TM
  DNA  Modification 
Kit  was  purchased  from  Epigentek  (USA).  Deoxyribonucleoside  triphosphates  (dNTPs) 
were purchased from Fermentas (MBI Fermentas, Lithuania).  
 
3.5.  Buffers and Solutions 
 
3.5.1.  DNA Extraction from Peripheral Blood 
 
Cell Lysis Buffer 
 

155 mM NH
4
Cl 
   
 
 
 
10 mM KHCO
3
 
   
 
 
 
1 mM Na
2
EDTA (pH 7.4) 
 
Nuclei Lysis Buffer   

10 mM Tris-HCl (pH 8.0) 
   
 
 
 
400 mM NaCl 
   
 
 
 
2 mM Na
2
EDTA (pH 7.4) 
 

 
52 
Sodiumdodecylsulphate  

10 per cent SDS (w/v) (pH 7.2) 
Proteinase K   
 

20 mg/ml  
 
TE Buffer 
 
 

20 mM Tris-HCl (pH 8.0) 
 
   
 
 
 
0.1 mM Na
2
EDTA (pH 8.0) 
 
5 M NaCl solution 
 

292.2 g NaCl in 1 l dH
2

 
3.5.2.  Polymerase Chain Reaction (PCR)  
 
10 X MgCl
2
 Free Buffer 
 

500 mM KCl 
 
 
 
 
 
 
100 mM Tris-HCl (pH 9.0) 
   
 
 
 
 
1 per cent Triton X-100 (Promega, USA)
 
   
 
 
 
10 X PCR Buffer  
 
 

100 mM Tris-HCl (pH 8.8 at 25 °C)
 
 
 
 
 
 
 
500 mM KCl 
0.8  per  cent  Nonidet  P40  (Fermentas,       
Lithuania) 
   
 
 
 
 
 
10 X PCR Buffer  with (NH
4
)
2
SO


750 mM Tris-HCl (pH 8.8 at 25 °C)
 
   
 
 
 
 
200 mM (NH
4
)
2
SO
4
 
   
 
 
 
 
0.1 per cent Tween 20 (Fermentas, Lithuania) 
 
MgCl

                                                : 
25 mM MgCl

(Fermentas, Lithuania and           
Promega, USA) 
 
3.5.3.  Agarose Gel Electrophoresis  
 
10 X Tris-Borate-EDTA Buffer 

0.89 M Tris-Base 
   
 
 
 
 
0.89 M Boric Acid 
   
 
 
 
 
20 mM Na
2
EDTA (pH 8.3) 
 
1, 2 or 3 per cent Agarose Gel 

1, 2 or 3 per cent (w/v) Agarose in 0.5 X  

 
53 
   
 
 
 
 
TBE Buffer 
 
Ethidium Bromide  
 
 

10 mg/ml  
 
10 X Loading Buffer   
 

2.5 mg/ml Bromophenol Blue 
   
 
 
 
 
1 per cent SDS in 2 ml glycerol 
 
3.5.4.  Polyacrylamide Gel Electrophoresis 
 
10 X TBE Buffer 
 

0.89 M Tris-Base 
   
 
 
 
0.89 M Boric Acid 
   
 
 
 
20 mM Na
2
EDTA (pH 8.3) 
 
30 per cent Acrylamide Stock : 
29 per cent Acrylamide 
(29:1)   
 
 
 
1 per cent N, N'-methylenebisacrylamide 
 
8 per cent Denaturing Gel 

8 per cent Acrylamide Stock (19:1) 
8.3 M Urea 
1X TBE Buffer (pH 8.3) 
 
Ammoniumpersulfate  

10 per cent APS (w/v)  
 
10X Denaturing Buffer 

95 per cent Formamid 
20 mM EDTA 
0.05 per cent Xylene Cyanol 
0.05 per cent Bromophenol Blue 
 
3.5.5.  Silver Staining  
 
Buffer A 
 
 

10 per cent Ethanol 
   
 
 
 
0.5 per cent Glacial Acetic Acid 
 
Buffer B 
 
 

0.1 per cent AgNO
3
 in dH
2


 
54 
Buffer C 
 
 

1.5 per cent NaOH 
0.01 per cent NaBH
4
 
0.015 per cent Formaldehyde 
 
Buffer D 
 
 

0.75 per cent Na
2
CO
3
 
 
 
3.6.  Equipments 
 
Automated DNA Sequencing and Quantitative Fluorescent Multiplex PCR analyses 
were perfomed using ABI 3100 and 3130 PRISM (Applied Biosystems) in Iontek and Burc 
Laboratories  (Istanbul,  Turkey),  respectively.  Other  experiments  were  performed  using 
facilities  of  the  Department  of  Molecular  Biology  and  Genetics  at  Boğaziçi  University 
(Istanbul, Turkey). The equipments used were as follows: 
  
Autoclave 
 
 

Model MAC-601 (Eyela, Japan) 
 
Balances 
 
 

Electronic Balance Model VA124 (Gec Avery, UK)  
Electronic Balance Model CC081 (Gec Avery, UK) 
 
Centrifuges 
 
 

Centrifuge 5415C (Eppendorf, Germany) 
   
 
 
 
Universal 16R (Hettich, Germany) 
 
Deep Freezers  
 

-20°C (Bosch, Germany) 
   
 
 
 
-70°C (GFL, Germany) 
 
Documentation System 

GelDoc Documentation System (Bio-Rad, USA) 
 
Electrophoretic Equipments  : 
Horizon 58, Model 200 (BRL, USA) 
   
 
 
 
Sequi-Gen Sequencing Cell (Bio-Rad,USA) 
   
 
 
 
DGGE System Model # DGGE-200 (C.B.S.  
Yüklə 4,8 Kb.

Dostları ilə paylaş:
1   2   3   4   5   6   7   8   9   ...   13




Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azkurs.org 2020
rəhbərliyinə müraciət

    Ana səhifə