From mutations to disease mechanism in rett syndrome, breast cancer, and congenital hypothyroidism


  The Effect of DNA Concentration on Reliability and Reproducibility of SYBR



Yüklə 4,8 Kb.
Pdf görüntüsü
səhifə8/13
tarix05.05.2017
ölçüsü4,8 Kb.
1   ...   5   6   7   8   9   10   11   12   13

4.1.10.  The Effect of DNA Concentration on Reliability and Reproducibility of SYBR 
Green Dye-based Real Time PCR Analysis to Detect the Exon Rearrangements 
 
4.1.10.1.  Preparation of DNA Samples. Photometric measurement of the stock DNA and 
the dilutions of 200 ng/µl were performed on an ND-1000 spectrophotometer (NanoDrop 
Technologies).  DNA  was  diluted  first  to  200  ng/µl,  stored  at  37  °C  overnight,  and  then 
diluted to final concentration of 0.025 ng/µl. Six dilutions at concentrations of 0.025, 0.25, 
1.25,  12.5,  25,  and  50  ng/µl  were  prepared  from  the  patient  R23  with  MECP2  exon  3 
deletion, patient R19 with MECP2 exon 3 duplication, and  two healthy females and one 
male.  Standards  (1.25,  2.5,  and  5  ng/µl)  were  prepared  by  dilution  of  a  healthy  female 
genomic DNA. All dilutions were prepared in a volume of 200 µl.  
 
4.1.10.2.  Quantitative Real Time PCR Conditions. The real time PCR was performed in a 
total  volume  of  20  µl,  containing  10  µl  2X  SYBR  Green  PCR  Master  Mix  (TaKaRa, 
Japan),  1  µl  of each  primer  per  reaction,  4  µl  of  the  genomic  DNA dilution  and  distilled 
water. The PCR protocol on Light Cycler (LC) (Roche Diagnostics, Mannheim, Germany) 
was as follows: an initial denaturation step (95°C for 2 min) followed by amplification and 
quantification steps repeated for  40-50 cycles (95°C for 5 sec, 59°C for 10 sec, 72°C for 
20 sec, with a single fluorescence measurement at the end of the elongation step at 72°C), a 
melting curve program (65–98°C with a heating rate of 0.2°C per second and a continuous 
fluorescence measurement) and terminated by cooling to 40°C. Each sample was amplified 
with  the  MeCP2  and  reference  gene  primer  pairs.  The coding  exon  3  of  the MeCP2  was 

 
 
66 
 
amplified  using  the  following  primers  designed  by  Bienvenu  et  al.  (2000);  Rett_exon3F: 
gtgatacttacatacttgtt; Rett_exon3R: ggctcagcagagtggtgggc. The reference NDRG1 gene was 
amplified  using  primers  NDRG1_exon7F:  aggctcccgtcactctg;  NDRG1_exon7R: 
gtcttccttcatcttaaaatg (Kalaydjieva et al., 2000).  
 
Each target and reference gene assay included: 1) a standard curve of three dilution 
points  of  healthy  female  DNA  (20,  10,  and  5  ng),  2)  20  ng  of  calibrator  healthy  female 
DNA,  and  3)  test  sample  DNAs.  Melting  point  analysis  was  conducted  on  all  PCR 
products to check for any nonspecific amplicons.  
 
4.1.10.3.    Quantification.  Quantification  was  performed  using  both  the  standard  curve 
method and the comparative Ct method. Within each PCR batch three aliquots of wild type 
control DNA in decreasing concentrations (20, 10, and 5 ng) from a healthy female were 
included to construct a standard curve and the copy numbers of the exons in each sample 
were interpolated. Since two different standard curves were constructed for the target and 
reference genes, the copy numbers of MECP2 exon 3 were normalized against a calibrator 
DNA sample. After normalization to the calibrator, the copy number of MECP2 exon was 
calculated by dividing these normalized values by the copy number of the reference gene. 
 
Instead of interpolating unknown samples from a standard curve, it is also possible to 
calculate the copy number based on the observed Ct values as follows: 
 
2 
-
CT
 =  (1+E) 

C
T
targetgene 

C
T
referencegene 
  (4.1) 
 
Where E is the efficiency of the PCR reaction (set at default value 0.95),  C
T
targetgene 
is the 
difference in threshold cycle value between test sample and calibrator sample for the gene 
under investigation (test gene), and  C
T
referencegene
 is the difference in threshold cycle value 
between test sample and calibrator sample for reference gene. 
 
4.1.10.4.    Statistical  Analysis.  The  results  were  evaluated  by  a  paired  sample  t-test  and 
Pearson correlation coefficient using SPSS v 15.0 software (SPSS Inc., Chicago, IL, USA). 

 
 
67 
 
4.2.  Methylation Analyses of the Putative Promoter Region of hHR23 Genes in 
Breast Tumor Tissues 
 
4.2.1.  Non-heating DNA Extraction Protocol 
 
Genomic  DNA  was  extracted  from  archival  formalin-fixed,  paraffin-embedded 
human  primary  breast  tumors  and  normal  breast  tissues  by  using  a  modified  version  of 
non-heating DNA extraction protocol described by Shi et al. (2002). Two sections (10 µm 
thick) were obtained from each archival tissue. Sections were deparaffinized by adding 1 
ml of xylene to the eppendorf tube for 30 min for two changes, followed by 100 per cent 
and 75 per cent ethanol for 15 min with three changes. After a washing step with PBS for 
15 min in two changes, 500 µl of tissue lysis buffer was added and incubated at 50 ºC for 
48-72 hours until the whole tissue were dissolved completely. The mixture was centrifuged 
at  13,000  rpm  for  5  min  and  the  supernatant  fluid  was  transferred  to  a  clean  eppendorf 
tube.  Five  hundred  µl  of  phenol:chloroform:isopropanol  solution  (25:24:1)  was  added, 
vortexed and centrifuged at 13,000 rpm for 10 min. The upper aqueous layer was carefully 
transferred to a clean tube, 0.1 volume of 3M sodium acetate and 1 volume of isopropanol 
were  added,  mixed  by  vortexing,  and  incubated  at  –  20  ºC  for  10  min.  The  DNA  was 
precipitated by centrifugation at 13,000 rpm at 4 ºC. The supernatant fluid was discarded 
and the precipitate washed once with 75 per cent ethanol. The DNA pellet was dissolved in 
50  µl  of  distilled  H
2
O.  The  concentration  of  the  isolated  DNA  was  calculated  after 
measuring  the  optical  density  at  260  nm  on  ND-1000  spectrophotometer  (NanoDrop 
Technologies). 
 
4.2.2.  Promoter Region Analyses and Primer Design 
 
The  web-based  PROSCAN  program  (Prestridge,  1995)  was  used  to  predict  the 
putative  eukaryotic  Pol  II  promoter  sequences  in  primary  sequence  data  of  hHR23A  and 
hHR  23B  genes.  MATCH  and  PROSCAN  programs  were  used  to  identify  high  scoring 
transcription  factor  (TF)  binding  sites.  MethPrimer  program  (Li  and  Dahiya,  2002)  was 
used  to  identify  the  CpG  islands  and  design  the  primers  using  the  standard  criteria,  i.e., 
sequence was considered as a CpG island if there was a minimum G+C content of 50 per 

 
 
68 
 
cent  with  a  minimum  CpG  (obs)/CpG  (exp)  of  0.6  in  a  200-bp  window  length,  and  the 
sequence length was at least 500-bp.    
 
4.2.3.  Bisulfite Modification 
 
Genomic  DNA  was  modified  by  Methylamp
TM
  DNA  Modification  Kit  (Epigentek, 
NY,  USA)  according  to  the  manufacturer's  protocol.  Briefly,  0.25-1  µg  of  DNA  in  a 
volume  of  24  µl  was  denatured  by  adding  1  µl  of  denaturing  buffer  for  10  min  at  37°C. 
Bisulfite-Conversion buffer (125 µl) was added and mixed, and samples were incubated at 
65 °C for 2 h. Modified DNA samples were applied to columns, washed, and then eluted 
with 20 µl of elution buffer.    
 
4.2.4.  Amplification and Sequencing of the Bisulfite Modified DNA 
 
Semi-nested  PCR  strategy  was  used  to  investigate  the  methylation  status  of  the 
putative promoter region of hHR23 genes (Figure 4.2). Several primer combinations were 
used  to  get  successful  amplification  product.  The  primer  combinations  were  shown  in 
Figure 4.2. In general, 2.5 µl of the modified DNA was used in subsequent PCR reactions. 
First-round PCR reactions were performed in a total volume of 25 µl containing 2.5 µl of 
modified  DNA,  2.5  µl  of  10X  polymerase  buffer,  2.5  mM  MgCl
2
,  2.5  µl  of  dimethyl 
sulfoxide (DMSO), 200  µM dNTPs, 0.4 µM of each primer, and 2 U of Taq polymerase 
(Fermentas). The following PCR program was used: 94ºC for 4 min, followed by 40 cycles 
of 45 sec at 94 ºC, 45 sec at annealing temperature, 1 min at 72ºC, and a final extension 
step of 8 min at 72ºC. One micro liter of the first-round PCR product was then used as a 
template  in  the  second  round  of  PCR  with  a  mixture  that  contains  2.5  µl  of  10X 
polymerase  buffer,  2.0 mM  MgCl2,  200  µM  dNTPs,  0.4  µM  of each primer,  and  1  U  of 
Taq  polymerase  (Fermentas).  The  cycling  condition  was  as  follow:  denaturation  at  94°C 
for 5 min was followed by 35 cycles of amplification: 94°C for 30 sec, 30 sec at annealing 
temperature, and extension at 72°C for 30 sec. After the last cycle, an 8-min extension at 
72°C was performed.  
 
Five µl from the PCR product was run on two per cent agarose gel to check for the 
quality of amplification. PCR products were purified using QIAQuick PCR purification kit 

 
 
69 
 
(QIAGEN)  and  sequenced  with  automated  sequencer  ABI  3130  PRISM  (Applied 
Biosystems) in Burç Laboratory (Istanbul, Turkey).  
     
 
 
Figure 4.2.  Semi-nested PCR strategy showing the primers and PCR cycling conditions 
used to investigate the methylation status of hHR23 genes. 
 
 
4.3.  Molecular Basis of Congenital Hypothyroidism (CH) 
 
4.3.1.  Mutation Analysis of the TTF2 Gene 
 
Genomic  DNA  was  isolated  from  peripheral  blood  sample  of  the  patient  with  CH, 
her consanguineous parents and unaffected brother using salting out method as described 
in section 4.1.1. 
 
4.3.1.1.    Direct  DNA  Sequencing  Analysis.  The  entire  coding  region  of  TTF2  gene 
(accession no. NM_004473) was amplified in two overlapping fragments using the primers 

 
 
70 
 
designed by Castanet et al (2002). PCR reaction was performed in a total volume of 25 µl 
containing approximately 100 ng DNA, 2.5 µl of 10X polymerase buffer, 2.0 mM MgCl2, 
10 per cent dimethyl sulfoxide (DMSO), 200 µM dNTPs, 0.4 µM of each primer, and 1 U 
of Taq polymerase (Fermentas,). The following PCR program was used: 94ºC for 4 min, 
followed  by  35  cycles  of  45  sec  at  94  ºC,  30  sec  at  annealing  temperature  (58ºC  for 
TTF2A-D, 53ºC for TTF2C-E), 1 min at 72ºC, and a final extension step of 8 min at 72ºC 
(Table  1.1.1).  The  PCR  products  were  purified  and  bi-directionally  sequenced  using  the 
primers TTF2A and TTF2C as described in section 4.1.4.    
 
4.3.1.2.    AlwNI  Digestion.  The  PCR  products  from  the  patient,  her  parents,  unaffected 
brother and 100 control chromosomes were subjected to AlwNI digestion. Genomic DNA 
was amplified using the primers TTF2C/TTF2E as described in section 4.2.1.1. A total of 
ten µl of the PCR product was digested with 3U of AlwNI restriction enzyme (Fermentas) 
and 2 µl of 10X reaction buffer in a 20 µl reaction volume. The mixture was incubated at 
37 ºC for 4 hours. The digested products were electrophoresed on two per cent agarose gel 
at  100  V  for  30  min.  The  c.  304  C>T  (p.R102C)  mutation  creates  a  new  restriction  site 
resulting in 72 bp and 599 bp fragments whereas wild type allele remains undigested. 
 
4.3.2.  Functional Characterization of p.R102C Mutant TTF2  
 
Functional analyses were performed by Dr. Chatterjee’s laboratory in University of 
Cambridge,  UK.  The DNA binding  and  transcriptional  properties  of  the mutant and  wild 
type  TTF2  have  been  investigated  as  described  by  Clifton-Bligh  et  al.  (1998).  Detailed 
information was given in Appendix A.  
  
4.3.3.  Mutation Analysis of Butyrylcholinesterase (BChE) Gene 
 
The DNA samples of the patient with CH and her family members were analyzed for 
the  presence  of  two  most  common  BChE  variants;  p.Asp70Gly  (A-variant)  and 
p.Ala539Thr (K-variant) according to Asanuma et al. (1999) and Maekawa et al. (1995), 
respectively.  PCR  reaction  was  performed  in  a  total  volume  of  25  µl  containing 
approximately  100  ng  DNA,  2.5  µl  of  10X  polymerase  buffer,  2.0  mmol/l  MgCl
2
,  0.2 
mmol/L dNTPs, 0.4 µmol/l of each primer, and 1 U of Taq polymerase (MBI Fermentas). 

 
 
71 
 
The PCR program on Icycler
TM
 thermal cycler was as follows: an initial denaturation step 
at  94  ºC  for  4  min,  followed  by  33  cycles  of  30  sec  at  94  ºC,  30  sec  at  annealing 
temperature  (52  ºC  for  M6/M115,  60  ºC  for  AP5/C539),  30  sec  at  72  ºC,  and  a  final 
extension step of 8 min at 72 ºC.  
 
The 373 bp region containing the p.Asp70Gly mutation site was amplified using the 
primers  M6/M115  and  digested  with  the  3U  of  the  Sau3AI  restriction  enzyme  (MBI 
Fermentas).  The  PCR  product  was  digested  to  214  and  135  bp  fragments  from  the  wild 
type  allele  and  remained  undigested  from  the  mutant  allele.  Similarly,  103  bp  product 
harboring  the  p.Ala539Thr  mutation  site  was  amplified  using  primers  AP5/C539.  The 
mutation  abolishes  AluI  restriction  recognition  site  resulting  in  an  undigested  103  bp 
product for mutant allele whereas wild type allele digested into two fragments of 83 and 20 
bp. The digested products were electrophoresed on three per cent agarose gels at 100 V for 
30 min. The fragments were visualized by ethidium bromide staining under UV light. 
 

 
72 
5.  RESULTS 
 
 
5.1.  Molecular Basis of Rett Syndrome  
 
5.1.1.  Patients 
 
The molecular basis of Rett Syndrome (RTT) in our population was investigated in a 
total  of  71  isolated  RTT  cases  (68  female  and  3  male).  A  detailed  clinical  data  were 
available for 47 patients (44 females and 3 males). Huppke clinical scoring (Huppke et al., 
2003)  was  also  available  for  33  of  these  cases.  The  clinical  features  of  these  patients 
analyzed in this study are summarized in Table 5.1. Twenty-four female patients had been 
referred to our laboratory for differential diagnosis but the clinical data were not available. 
All  patients  were  screened  for  MECP2  gene  mutations  but  quantitative  PCR  and  XCI 
analyses were performed only for the first group of 47 patients.  
 
5.1.2.  Mutation Analysis of MECP2 Gene 
 
All  patients  were  initially  screened  for  the  six  recurrent  MECP2  mutations 
(p.R106W, p.T158M, p.R168X, p.R255X, p.R270X, and p.R306C) since these mutations 
are  known  to  account  for  up  to  two  thirds  of  pathogenic  mutations  in  RTT  cases 
(RettBASE). The PCR-RFLP based analyses detected mutation in 15 patients: four patients 
(R6,  R18,  R22,  and  R28)  with  p.R106W,  three  patients  (R25,  R29,  and  R47)  with 
p.T158M,  two  patients  (R15  and  R17)  with  p.R168X,  four  patients  (R9,  R13,  R24,  and 
R39)  with  p.R255X,  patient R34  with  p.R270X, and  patient R16  with  p.R306C  mutation 
(Figure 5.1). Patients tested negative for the recurrent mutations were further analyzed for 
the  four  coding  exons  of  the
 
MECP2  gene  using  SSCP  analysis.  Subsequent  DNA 
sequencing  of  patients  showing  altered  SSCP  pattern  revealed  ten  different  pathogenic 
mutations: 
c.1156-1192del36 
(p.Leu386Hisdel12), 
c.856delA 
(p.Leu286fsX288), 
c.397C>T  (p.Arg133Cys),  c.1034_1042insGCGGATTGC  (p.Lys345fs),  c.455C>G 
(p.Pro152Arg), 
c.964C>G 
(p.Pro322Ala), 
c.880C>T 
(p.Arg294X), 
c.744delG 
(p.Ser194fsX208),  and  c.826-829delGTGG  (p.Val276fsX288)  mutations  in  R2  and  R42, 
R3, R4, R8, R18, R31, R36, R46, and R49, respectively. 

 
73 
                            
 
                                    (a)                                                                    (b) 
 
          
 
                                    (c)                                                                    (d) 
 
 
(e) 
 
Figure 5.1.  PCR-RFLP analysis for the detection of the common MECP2 mutations in 
patients R17 (a), R24 (b), R6 (c), R29 (d), and R16 (e).    
 

 
74 
The molecular analysis revealed 18 different MECP2 mutations in 30 of 44 (68.2 per 
cent) female patients in the first group of classical/atypical RTT cases with detailed clinical 
data  (Figure  5.2).  Of  the  30  patients  with  mutations,  10  had  a  missense,  eight  had  a 
nonsense  mutation,  six  had  small  nucleotide  deletion/insertions.  The  p.R255X  and  p. 
R106W were the most common mutations with an equal frequency of 8.9 per cent in our 
cohort of patients. Five mutations were novel to this study: p.Ser194fsX208 (c.744delG), 
p.Val276fsX288  (c.826-829delGTGG),  p.Leu286fsX288  (c.856delA),  p.Leu386Hisdel12 
(c.1156-1192del36) and p.Lys345fs (c.1034_1042insGCGGATTGC) (Figure 5.3 and 5.4). 
Eighty percent (20 of 25) of the small deletion/insertion or point mutations were detected 
in  the  exon  4  of  the  MECP2  gene.  The  rest  of  the  mutations  (20    per  cent)  were  located 
within exon 3. Exons 1 and 2 were free of sequence variations. All patients reported were 
heterozygous  for  the  identified  mutations  except  patient  R18  that  was  found  to  be  a 
compound  heterozygote  for  p.R106W  and  p.P152R  mutations.  All  available  family 
members  were  tested  negative  for  the  identified  variations  implicating  de  novo  nature  of 
the  mutations.  MECP2  gene  mutations  could  not  be  identified  in  any  of  the  three  male 
patients.  
 
MECP2
 mutations could be detected in three of the 24 patients in the second group 
that were referred for differential diagnosis. One of these mutations was a complex small 
insertion in patient R60 and the others were p.R106W and p.R255X identified in patients 
R68 and R69, respectively.   
 
5.1.3.  Quantitative PCR Analyses 
 
We have developed a quantitative real time PCR strategy to screen for MECP2 exon 
rearrangements  in  23  samples  (20  females  and  3  males)  that  were  negative  for  MECP2 
point mutations. Each sample was amplified with the MECP2 and reference NDRG1 gene 
primer  pairs.  The  amplification  products  were  analyzed  using  the  Light  Cycler  analysis 
software (version 4.0) (Figure 5.5). Using the Fit Points Method, the DNA was quantified 
relative  to  the  standard  curve  for  each  exon.  Subsequently,  the  ratios  between  target 
(MECP2) and reference (NDRG1) exon were calculated for each test person.  
 

 
75 
The  observed  mean  ratios  are  0.52±0.12  for  deletion  carriers  (expected  value:  0.5) 
and  1.56±0.18  for  duplication  carriers  (expected  value:  1.5)  vs.  1.022±0.17  for  control 
individual  (expected  value:  1.0).  MECP2  exon  rearrangements  were  identified  in  seven 
female patients; four with exon 2-4 duplications (R14, R19, R20, and R33), one with exon 
3  deletion  (R23),  one  with  exon  4  deletion  (R30),  and  one  with  exon  3-4  deletions  (R5) 
(Table 5.2, Figure 5.6). 
 
QF-PCR assay was used to verify the results obtained by quantitative real time PCR 
analysis (Figure 5.7). The observed ratios of MECP2 exon 3/PRNP exon 2 were 1.02±0.09, 
0.47±0.04, and 1.69±0.21 for the control individuals, exon 3 deletion carriers and exon 3 
duplication carriers, respectively (Table 5.2, Figure 5.6). QF-PCR confirmed the presence 
of  exon  rearrangements  except  the  MECP2  gene  duplication  observed  in  patient  R33 
(Figure 5.8).      
 
 
Figure 5.2.  Schematic representation of the MeCP2 (a) and MECP2 gene (b) showing the 
position of the mutations identified in this study. Numbers in brackets represent the 
number of the patients with the same mutation.   
 
 
 

 
76 
 
 
 
Figure 5.3.  SSCP gels showing altered migration patterns for patients R3 (a), R2 (b), R8 
(c), R46 (d), and R47 (e) with novel MECP2 gene mutations.  
(a) 
(b) 
(c) 
(d) 
(e) 

 
77 
 
 
Figure 5.4.  Chromatograms showing sequencing profiles of sense (left panel) and 
antisense (right panel) strands of MECP2 gene for the novel mutations identified in the 
present study. (a, b) Patient R2 with c.1156-1192del36; (c, d) patient R3 with c.856delA; 
(e, f) patient R8 with c.1034_1042insGCGGATTGC; (g, h) patient R46 with c.744delG; 
and (i, j) patient R47 with c.826-829delGTGG. Arrows show the site of the mutations. 

 
78 
Table 5.1.  The age, gender, and clinical and genetic features of the first group of 47 patients. 
 
 

 
79 
Table 5.1.  The age, gender, and clinical and genetic features of the first group of 47 patients (continued). 
 
*ND: no data; NI: not-informative; **The duplication identified in this patient by Real Time PCR could not be reproduced with QF-PCR 
 

 
80 
 
(a) 
 
(b) 
 
(c) 
Figure 5.5.  A representative Real Time analysis for a healthy female (a), R5 with exon 3 
deletion (b), and R19 with exon 3 duplication (c), respectively.    

 
81 
Table 5.2.  Quantitative Real Time PCR and QF-PCR analyses result.  
 
 
Quantitative Real Time PCR 
QF-PCR 
Samples 
Exon 3 
(MECP2/NDRG1) 
Exon 4 
(MECP2/NDRG1) 
Exon 3 
(MECP2/PRNP) 
Yüklə 4,8 Kb.

Dostları ilə paylaş:
1   ...   5   6   7   8   9   10   11   12   13




Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azkurs.org 2020
rəhbərliyinə müraciət

    Ana səhifə