Supplementary Table : Primers used for real-time pcr experiments



Yüklə 0,7 Mb.
səhifə1/5
tarix21.04.2017
ölçüsü0,7 Mb.
  1   2   3   4   5
Supplement

Supplementary Table : Primers used for real-time PCR experiments.



gene

full gene name

Assay name or sequence

BTC

betacellulin

Hs_BTC_1_SG

EGFR

epidermal growth factor receptor

Hs_EGFR_vb.1_SG

WNT2B

wingless-type MMTV integration site family, member 2B

Hs_WNT2B_va.1_SG

SULT4A1

sulfotransferase family 4A, member 1

Hs_SULT4A1_1_SG

ABCB1

ABC-Transporter B1 (P-glycoprotein)

Hs_ABCB1_1_SG

PIK3R5

phosphoinositide-3-kinase, regulatory subunit 5

HS_PIK3R5_1_SG

CYP3A43

cytochrome P450 3A43

HS_CYP3A43_1_SG

HBEGF

heparin-binding EGF-like growth factor

HS_HBEGF_1_SG

TCF7L2

transcription factor 7-like 2

Hs_TCF7L2_1_SG

ERBB3

epidermal growth factor receptor 3

Hs_ERBB3_vb.1_SG

FZD7

frizzled homolog 7

Fwd: CCTTCCCCTTCTCATGCCC

Rev: CAGCCCGACAGGAAGATGAT



MAPK9

mitogen-activated protein kinase 9

Hs_MAPK9_va.1_SG

PRKCA

protein kinase C, alpha

Hs_PRKCA_1_SG

TCF7

transcription factor 7

Hs_TCF7_va.1_SG

CACNA2D3

calcium channel, voltage-dependent, alpha 2/delta subunit 3

Hs_CACNA2D3_1_SG

GAPDH

Glyceraldehyde 3-phosphate dehydrogenase

Hs_CACNA2D3_1_SG

Supplementary Figure 1: Clinical data of microarray cell lines



Abbreviations: TCA (tricyclic antidepressants), SSRI (selective serotonin reuptake inhibitors), SNRI (serotonin-norepinephrine reuptake inhibitors), NASSA (noradrenergic and specific serotonergic antidepressant), NARI (noradrenalin-reuptake-inhibitor), BZD (benzodiazepines), SLP (sleep medication)
Supplementary Table 2: Clinical Data Overview



Abbreviations: f (female), m (male), TCA (tricyclic antidepressants), SSRI (selective serotonin reuptake inhibitors), SNRI (serotonin-norepinephrine reuptake inhibitors), NASSA (noradrenergic and specific serotonergic antidepressant), NARI (noradrenalin-reuptake-inhibitor), SSRE (selective serotonin reuptake enhancer)

Supplementary Table 3: Microarray results (fold changes) of identified genes being involved GO terms of brain remodeling processes. Mean values and standard deviations (sd) of responder (R) and non-responder (NR) derived cell lines are indicated as well as p-values calculated by Wilcoxon-Mann-Whitney rank-sum test. Significant p-values are in bold.



genes

cell lines

mean (sd)

ProbeName

Symbol

1WXV

2411

24DC

275J

275U

278D

278H

278S

96

CY24

R

NR

p-value

A_24_P282416

ABL1

-1,1

-1,2

-1,5

-2,5

-2,1

1,1

-1,3

1,2

-1,9

1,0

-0,8

±

1,6

-0,9

±

1,3

1,00

A_23_P135769

ACTB

1,1

-1,5

2,1

2,3

5,0

2,1

-1,0

-1,3

-1,7

-2,0

1,9

±

2,0

-1,6

±

0,4

0,02

A_23_P105957

ACTN1

-1,1

-1,5

-2,1

-2,4

-1,1

1,4

-1,3

-1,3

-2,4

-2,0

-1,1

±

1,3

-1,8

±

0,5

0,35

A_23_P101655

ACTN4

-1,2

-1,8

-2,2

-3,0

1,2

1,6

-1,6

-1,3

-2,7

-2,2

-0,8

±

1,9

-2,1

±

0,5

0,26

A_33_P3408983

APC

-1,2

1,4

2,5

4,4

1,7

1,2

1,7

1,7

2,4

1,4

1,7

±

1,8

1,7

±

0,5

1,00

A_23_P73511

ARAF

1,0

-1,0

-2,0

-2,6

-1,1

1,4

-1,6

-1,4

-2,2

-1,6

-0,8

±

1,6

-1,6

±

0,5

0,61

A_24_P298027

AXIN2

4,2

1,2

2,6

1,7

1,2

1,1

-1,3

-1,1

-1,9

1,1

1,6

±

1,7

-0,2

±

1,6

0,11

A_23_P148015

AXIN2

1,2

1,1

1,0

-1,6

-5,8

-3,4

1,1

-1,1

-1,0

1,4

-1,6

±

2,7

0,6

±

1,1

0,11

A_33_P3398526

BCL2L11

-1,1

-1,2

1,5

3,0

2,6

-1,1

1,1

-1,3

-1,4

-1,1

0,6

±

2,0

-0,6

±

1,2

0,11

A_33_P3251932

BCL2L11

-1,2

-1,6

-2,1

-1,7

-1,7

-1,3

-1,2

-1,4

-2,0

-1,6

-1,6

±

0,3

-1,6

±

0,3

0,26

A_23_P135722

BTC

1,8

-1,1

107,1

103,2

30,6

-1,1

2,1

-1,9

-1,0

-1,3

40,0

±

52,0

-0,3

±

1,6

0,91

A_23_P373031

CACNA1C

-1,1

-1,4

2,7

4,2

2,1

1,1

-1,0

-1,4

-1,3

-1,5

1,3

±

2,2

-1,3

±

0,2

0,35

A_33_P3297580

CACNA1C

4,6

-1,1

-2,1

1,0

-4,0

-2,6

-4,3

1,2

1,2

-1,5

-0,3

±

3,2

-1,4

±

2,2

0,07

A_33_P3825869

CACNA1C

-7,1

-1,0

-3,0

1,4

-3,8

-1,9

1,3

1,2

-5,4

1,2

-2,2

±

3,2

-1,0

±

3,1

0,76

A_23_P365767

CACNA1D

-1,2

1,6

-1,1

2,2

3,6

-1,2

1,1

1,1

-2,2

-2,0

0,6

±

2,1

-0,4

±

2,0

0,61

A_23_P148327

CACNA1F

1,0

1,0

1,3

-1,1

-6,4

-1,5

1,0

-1,1

-1,6

1,6

-1,3

±

2,8

0,5

±

1,5

0,35

A_23_P85765

CACNA1S

1,1

-1,2

-4,1

-2,4

-1,6

-1,1

-1,4

-1,3

1,0

1,1

-1,6

±

1,7

-0,1

±

1,4

0,48

A_24_P91165

CACNB1

-1,2

1,3

1,5

2,9

3,0

1,1

-1,2

-1,1

-1,8

-1,3

1,0

±

1,8

-0,7

±

1,4

0,26

A_33_P3285277

CACNB2

1,5

-2,3

-1,1

3,9

2,8

-1,0

-1,1

1,1

1,4

-1,1

1,2

±

2,0

-0,8

±

1,5

0,07

A_33_P3363271

CACNB2

1,2

1,0

-1,1

-2,3

-2,8

-1,2

-1,3

1,2

1,3

-1,3

-0,8

±

1,7

-0,1

±

1,4

0,11

A_33_P3221989

CACNB4

1,1

1,4

1,1

1,7

-2,1

-1,2

-1,0

1,4

2,3

3,8

0,3

±

1,6

1,6

±

2,0

0,76

A_23_P300056

CDC42

1,2

1,1

-1,8

-3,1

-2,2

-1,5

-1,0

1,3

1,5

1,0

-1,0

±

1,8

0,6

±

1,1

0,17

A_24_P81841

CDKN1B

-1,1

1,4

-1,2

-1,7

-2,2

-1,1

1,3

1,3

2,2

1,9

-1,0

±

1,2

1,7

±

0,4

0,26

A_24_P270814

CRK

1,1

-1,1

-2,5

-4,7

-3,6

1,6

-1,3

-1,2

-1,8

-1,4

-1,5

±

2,5

-1,4

±

0,3


Yüklə 0,7 Mb.

Dostları ilə paylaş:
  1   2   3   4   5




Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azkurs.org 2020
rəhbərliyinə müraciət

    Ana səhifə