Organizing co mmittee



Yüklə 5,12 Mb.
Pdf görüntüsü
səhifə191/351
tarix17.10.2023
ölçüsü5,12 Mb.
#156508
1   ...   187   188   189   190   191   192   193   194   ...   351
Abstracts ICPS 2023

References: 
 
1.
Sato J.D, Kan M. Media for culture of mammalian cells. Curr Protoc Cell Biol. 
2001; Chapter 1(Unit 1.2)
2.
Coté R.J. Aseptic technique for cell culture. Curr Protoc Cell Biol. 2001; 
Chapter 1(Unit 1.3) 
This reference contains a protocol for proper sterile technique 
using a laminar flow hood
3.
Phelan M.C. Basic techniques in mammalian cell tissue culture. Curr. Protoc. 
Cell Biol. 2007; Chapter 1 (Unit 1.1). 
 
 


Poster presentation 
188 
INFLUENCE OF MELTING TEMPERATURE (TM) ON THE 
EFFICIENCY OF PCR REACTION IN GENE EXPRESSION 
STUDY 
 
A.A. Makhnev, A.B. Baimirzaev, E.A. Makhneva, D.R. Mansurov
Kh.Z. Nasriddinov, O.B. Alimukhamedova, G.A. Piakina 
 
S.Yu. Yunusov Institute of the Chemistry of Plant Substances Academy of sciences of the 
Republic of Uzbekistan st. Mirzo-Ulugbek, 77, 100170 Tashkent 
 
The study of gene expression allows us to understand what biochemical processes occur in 
the body, how they are associated with various diseases (oncological, genetic) and the 
mechanism of action of drugs. For this, quantitative real-time PCR analysis is used using 
fluorescently labelled oligonucleotides or intercalating dyes. The level of gene expression is 
assessed by the values of threshold cycles (Ct) - the cycle at which the growth of the 
fluorescent signal occurs. The earlier the threshold cycle occurs, the higher the gene 
expression level. 
The reliability of quantitative assessment of the level of expression of the studied 
genes depends on the efficiency and accuracy of the developed PCR analysis. One of 
such factors affecting the accuracy of PCR analysis is correctly selected primers, but, in 
addition, the melting temperature (Tm) of a specific DNA region being detected has a 
great influence on the analysis efficiency. 
To study the effect of the GC composition of the amplified product on the efficiency of 
the PCR reaction, two pairs of primers for the GAPDH gene were designed, the 
expression level of which is determined to normalize the data in the study of various 
biological processes in the cell. Using the insilico method in the UGENE software, the 
first pair of primers GAPDHF002, CAAGAAGGTGGTGAAGCAGG; GAPDHR002, 
AGCGTCAAAGGTGGAGGAGT was designed to amplify a 118 bp gene region. with a 
melting point of 84 °C, the second pair of primers GAPDHF002, 
TGTTCCAATATGATTCCACCCA; GAPDHR002, TGGAAGATGGTGATGGGATTT 
amplify a 97 bp DNA fragment. with a melting point of 77 °C. Quantitative PCR analysis 
was performed using the designed primers and SYBRGreen intercalating dye on RNA 
samples isolated from cancer cultures of Hep cells (human hepatocellular carcinoma). 
As a result of the obtained data on the value of threshold cycles (Ct) of PCR analysis, 
it was found that during amplification of the DNA region of the GAPDH gene with a 
melting temperature of 77 °C, the growth of the fluorescent signal occurs at the 8th 
threshold cycle (Ct). While during amplification of the DNA region with a melting 
temperature of 84 °C, the fluorescent signal increases at the 12th threshold cycle (Ct). 
This shows that the efficiency of the PCR reaction is higher when amplifying DNA 
products with a lower melting point. Thus, it has been established that in order to obtain 
more accurate results when studying gene expression by PCR analysis, it is important to 
take into account not only the sequence and temperature of the designed primers, but 
also the melting temperature of the DNA region being amplified. 

Yüklə 5,12 Mb.

Dostları ilə paylaş:
1   ...   187   188   189   190   191   192   193   194   ...   351




Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azkurs.org 2025
rəhbərliyinə müraciət

gir | qeydiyyatdan keç
    Ana səhifə


yükləyin