CLONNING OF RECOMBINANT PLASMID pPICZαA-PNP, ENCODING THE PURINE NUCLEOSIDE PHOSPHORYLASE (PNP) IN PICHIA PASTORIS J.M. Abdurakhmanov, S.A. Sasmakov, Sh.Sh. Khasanov, O.N. Ashirov, F.B. Eshboev, Kh. Dolimov, T. Sadullaev, A. Yarilkaganova, S. Gaynazarova, Sh.S. Azimova S.Yu. Yunusov Institute of the Chemistry of Plant Substances Academy of sciences of the Republic of Uzbekistan st. Mirzo-Ulugbek, 77, 100170 Tashkent e-mail: genlab_icps@yahoo.com
Modified nucleosides are heterocyclic nitrogenous bases of natural or synthetic origin
containing monosaccharides - cyclic pentoses. Nucleoside analogs can be synthesized by
chemical or enzymatic methods, or a combination of these methods. The enzymatic
transglycosylation / (or) hydrolysis reaction is usually carried out at 50°C to inhibit other
enzymes such as deaminases. At this temperature, some nucleoside phosphorylases retain
most of their activity. It has been shown in the literature that
Escherichia coli purine
nucleoside phosphorylase (EC 2.4.2.1) is currently successfully used for the biocatalytic
preparation of N-β-
D -ribofuranosyl derivatives of heterocyclic nitrogen-containing bases.
The use of microorganisms producing nucleoside phosphorylases for the synthesis of
modified nucleosides of biological and pharmaceutical importance has proved to be
highly effective. At present, one of the most advanced expression systems that allow to
obtain recombinant proteins on an industrial scale is the yeast system of
Pichia pastoris .
Considering the above information, the aim of this work is to clone a recombinant
plasmid encoding
Escherichia coli purine nucleoside phosphorylase (PNP) in the
Pichia pastoris expression system.
Purine nucleoside phosphorylase cDNA (deoD gene, insert), size of 720 bp was
amplified by PCR using as a template genomic DNA isolated from cells of
Escherichia coli strain RKMUz - 221 (the strain was obtained from the collection of industrial
microorganisms of the Institute of Microbiology of the Academy of Sciences of the
Republic of Uzbekistan) using the following primers (a patent application has been filed
for these primers):
1) Forward – 5’- XXXXXXXATGCTACCCCACACATTAATGC -3’
2) Reverse – 5’- XXXXXXTTACTCTTTATCGCCCAGCAGAAC -3’
The amplificon (insert) was purified by precipitation with 0.5 M magnesium chloride
(in final concentration 0.05 M) and 96% ethanol (in final concentration 70%).
One μg of the transfer vector pPICZαA and PCR amplificates were sequentially
treated with FastDigest
EcoRI and FastDigest
XbaI restrictases (Thermo Scientific,
USA). Ligation of the pPICZαA vector with the target gene - purine nucleoside
phosphorylase was carried out in a volume of 10 μl in a molar ratio of 1:3, respectively,
using recombinant T4 DNA Ligase (Invitrogen).
In conclusion, the cloned new plasmid pPICZαA-PNP can be used for expression of
recombinant purine nucleoside phosphorylase (PNP, EC 2.4.2.1) enzyme in
Pichia pastoris .
Fund: The study was carried out within the framework of project F-FA-2021-360,
Ministry of Innovative Development of the Republic of Uzbekistan.