From mutations to disease mechanism in rett syndrome, breast cancer, and congenital hypothyroidism



Yüklə 4,8 Kb.
Pdf görüntüsü
səhifə7/13
tarix05.05.2017
ölçüsü4,8 Kb.
1   2   3   4   5   6   7   8   9   10   ...   13

 
 
 
Scientific Co., USA) 
 
 
 
 
 
Horizon 1020, Model H1 (BRL, USA) 

 
55 
PROTEAN  Vertical  electrophoresis  System  (Bio-
Rad, USA) 
 
Incubators 
 
 

Shake'n'Stack (Hybaid, UK) 
   
 
 
 
Oven EN400 (Nuve, Turkey) 
 
Magnetic Stirrer 
 

Chiltern Hotplate Magnetic Stirrer, HS31 (UK) 
   
 
 
 
 
Ovens   
 
 

Microwave Oven (Vestel, Turkey) 
   
 
 
 
 
Power Supplies 
 

Power Pac Model 3000 (Bio-Rad, USA) 
   
 
 
 
PSU 400/200 (Scie-Plus, UK) 
 
Refrigerator   
 

+4°C  (Arçelik, Turkey) 
 
Spectrophotometers   

NanoDrop ND-1000 (NanoDrop, USA) 
CE 5502 Scanning Double Beam 5000 Series 
 
 
 
 
 
(CECIL Elegant Technology, UK) 
 
Thermal Cyclers 
 

Icycler (Bio-Rad, USA) 
   
 
 
 
Mycycler (Bio-Rad, USA) 
 
 
 
 
 
 
 
 
Light-Cycler 1.5 (Roche, Germany) 
 
Vortex  
 
 

Nuvemix (Nuve, Turkey) 
 
Water Purification System 

WA-TECH Ultra Pure water Purification System 
 
 (WA-TECH, Germany) 

 
 
56 
 
4.  METHODS 
 
 
4.1.  Molecular Basis of Rett Syndrome (RTT) 
 
4.1.1.  DNA Extraction from Peripheral Blood 
 
Genomic DNA was extracted from peripheral blood by using a modified version of 
salting-out  method  described  by  Miller  et  al.  (1988).  Peripheral  blood  samples  were 
collected  from  individuals  into  vacutainer  tubes  containing  K
3
EDTA.  Thirty  ml  ice-cold 
red blood cell (RBC) lysis buffer is added to 10 ml blood sample and mixed thoroughly. 
The  samples  are  then  left  at  +4  ˚C  for  15  minutes  (min)  to  allow  lysis  of  erythrocyte 
membranes. Leukocyte nuclei were collected after centrifugation of lysed solution at 5000 
revolution  per  minute  (rpm),  +4  ˚C  for  10  min.  The  supernatant  was  discarded  and  the 
nuclei  were  resuspended  in  10  ml  RBC  lysis  buffer  by  vortexing.  Resuspension  was 
centrifuged  again  at  5000  rpm,  +4  ˚C  for  10  min.  After  discarding  the  supernatant,  the 
nuclear  pellet  was  resuspended  in  three  ml  nuclei  lysis  buffer  by  vortexing.  Thirty  µl  of 
Proteinase K and 40µl of 10 per cent SDS were added and the mixture was incubated at 37 
˚C overnight or at 56 ˚C for three hours. Afterwards ten ml of 2.5 M NaCl were added to 
mixture and centrifuged at 5000 rpm at room temperature for 20 min. The supernatant was 
transferred into a new 50 ml falcon tube. The DNA was precipitated with addition of two 
volumes  of  absolute  ethanol.  The  DNA  was  transferred  in  to  a  1.5  ml  Eppendorf  tube 
containing 200-500 µl of Tris-EDTA (TE) buffer, and left overnight at room temperature 
to dissolve completely. 
 
4.1.2.  Quantitative Analysis of the Extracted DNA 
 
The concentration of the isolated DNA was calculated measuring the optical density 
at 260 nm. The formula below was used, which is based on the fact that 50 µg of double 
stranded DNA has an absorbance of 1.0 at 260 nm. 
 
 
 

 
 
57 
 
4.1.3.  Mutation Analysis of MECP2 Gene  
 
The RTT patients were screened for mutations within the MECP2 gene using PCR-
RFLP, SSCP and subsequent DNA sequencing.  
 
4.1.3.1.    Restriction  Endonuclease  Analysis.  The  most  common  mutations  p.R106W, 
p.T158M, p.R168X, p.R255X, p.R270X, and p.R306C were screened in each patient using 
PCR-RFLP  as  a  preliminary  step.  The  region  containing  the  mutation  site  was  amplified 
using the primers given in Table 1. PCR reaction was performed in a total volume of 25 µl 
containing  approximately  100  ng  DNA,  2.5  µl  of  10X  polymerase  buffer,  2.0  mmol/l 
MgCl
2
,  0.2  mmol/L  dNTPs,  0.4  µmol/l  of  each  primer  and  1  U  of  Taq  polymerase 
(Fermentas). The PCR program on Icycler
TM
 (BioRad) thermal cycler was as follows: an 
initial denaturation step at 94 ºC for 4 min, followed by 33 cycles of 45 sec at 94 ºC, 30 sec 
at annealing temperature, 45 sec at 72 ºC, and a final extension step of 8 min at 72 ºC. Five 
µl from the PCR product was run on two per cent agarose gel to check for any nonspecific 
bands.  A  total  of  ten  µl  of  the  PCR  product  was  digested  with  3U  of  the  appropriate 
restriction  enzyme  (Fermentas)  and  2  µl  of  its  10X  reaction  buffer  in  a  20  µl  reaction 
volume (Table 4.1). The mixture was incubated at 37 ºC for 4 hours. The digested products 
were  electrophoresed  on  three  per  cent  agarose  gel  at  100  V  for  30  min.  The  gel  and 
running  buffers  were  0.5X  TBE.  The  fragments  were  visualized  by  ethidium  bromide 
under UV light. The genotyping was performed according to restriction fragment profiles 
(Table 4.1). 
 
4.1.3.2.  Single Strand Conformation Polymorphism. Patients were further screened for the 
presence  of  point  mutations  by  Single  Strand  Conformation  Polymorphism  (SSCP) 
analysis.  The  four  coding  exons  and  the  flanking  intronic  regions  were  amplified  in  ten 
overlapping  fragments  by  use  of  primers  listed  in  Table  1.1.1.  The  primers  designed  by 
Bienvenu  et  al.  (2000)  were  used,  except  for  the  exon  1.  The  sequences  of  the  exon  1 
primers  were  5'-ggacaggaaatctcgccaat-3'  (forward)  and  5'-cacggcggtcccactc-3'  (reverse). 
PCR reactions were carried out in a total volume of 50 µl containing approximately 200 ng 
DNA, 5 µl of 10X polymerase buffer, 2.0 mmol/l MgCl
2
, 0.2 mmol/L dNTPs, 0.4 µmol/l 
of  each  primer  and  2  U  of  Taq  polymerase  (Fermentas).  The  PCR  program on  Icycler
TM
 
(BioRad)  thermal  cycler  was  as  follows:  an  initial  denaturation  step  at  94  ºC  for  4  min, 

 
 
58 
 
followed by 33 cycles of 45 sec at 94 ºC, 30 sec at annealing temperature, 45 sec at 72 ºC, 
and a final extension step of 8 min at 72 ºC. Five µl from the PCR product was run on a 
two per cent agarose gel to check for any nonspecific bands.  
 
Table 4.1.  The list of the MECP2 gene mutations analyzed by PCR-RFLP method. 
Exon 
Mutation 
Restriction 
Enzyme 
Primers 
PCR 
product 
RFLP Results 
Exon 3 
p.R106W 
(c.316 C>T) 
Nla
lll 
Rett 2.1F  
Rett 2.2R  
277 bp 
Wt: 124 + 153 bp 
Mt: 34 + 90 + 153 bp 
Exon 4 
p.T158M 
(c.473 C>T) 
Nla
lll 
Rett 3AF  
Rett 3AR  
182 bp 
Wt: 182 bp 
Mt: 120 + 62 bp 
Exon 4 
p.R168X 
(c.502 C>T) 
Hph

Rett 3AF  
Rett 3AR  
182 bp 
Wt: 182 bp 
Mt: 150 + 32 bp 
Exon 4 
p.R255X 
(c.763 C>T) 
Hha

Rett 3CF  
Rett 3MR  
120 bp 
Wt: 90 + 30 bp 
Mt: 120 bp 
Exon 4 
p.R270X 
(c.808 C>T) 
Nla
lV 
Rett 3CF  
Rett 3CR  
410 bp 
Wt: 140+ 270 bp 
Mt: 410 bp 
Exon 4 
p.R306C 
(c.916 C>T) 
Hha

Rett 3CF  
Rett 3CR  
410 bp 
Wt: 250 + 160 bp 
Mt: 410 bp 
  
4.1.3.3.  Preparation of SSCP Gels. The amplification products were run on eight per cent 
acrylamide gels with or without four per cent glycerol. The glass plates of 180 mm x 200 
mm  were  cleaned  with  alcohol  to  remove  any  dust  and  oily  fingerprints.  Then,  0.7  mm 
thick spacers were placed on the two edges of the glass plates and the plates were tightened 
with  clamps.  The  eight  per  cent  acrylamide  solution  was  prepared  as  follows:  350  µl  of 
ammonium per sulfate (10 per cent) and 35 µl of TEMED were added in 9.3 ml of 30 per 
cent  stock  acrylamide  solution  (29:1  acrylamide  to  N,  N’-methlene-bis-acrylamide).  The 
mixture  volume was adjusted  to  35  ml  with  dH
2
0 and  poured  between  two  plates.  A  20-
well comb was inserted between the two plates and the gel was allowed to polymerize for 
at least one hour.  
 
 

 
 
59 
 
 
4.1.3.4.  SSCP Electrophoresis. An aliquot of 15 µl of the PCR product was mixed with 15 
µl of denaturing loading dye (95 per cent form amid, 0.05 per cent bromophenol blue, 0.05 
per cent xylene cyanol). Just before loading, they were denatured at 94°C for five min, and 
chilled  on  ice  for  five  min.  Thirteen  µl  of  the  denatured  sample  was  loaded  on  the  gel. 
Electrophoresis of the samples was carried out in 0.6 X TBE buffer at 150-250 V for 16 
hours.  
 
4.1.3.5.  Silver-Staining. The alleles, separated on gels, were visualized by silver-staining. 
The gel was incubated with buffer A for five min to fix the DNA fragment. Buffer A was 
replaced  with  buffer  B,  which  is  a  silver  nitrate  solution,  and  the  gel  was  left  for  10-15 
min.  After  a  short  wash  with  dH
2
O,  the  gel  was  immersed  in  freshly  prepared  buffer  C 
until  the  bands  appeared  (approximately  10  min).  After  color  development,  Buffer  D  is 
used  to  terminate  the  color  reaction  for  five  min.  The  gel  was  then  transferred  to  a 
transparent folder, and was sealed on all four sides for preservation. 
 
4.1.4.  DNA Sequence Analysis 
 
When a single strand conformation polymorphism was observed, genomic DNA was 
amplified using the same primer pairs used for SSCP and both forward and reverse strands 
were  sequenced.  Patient  and  control  PCR  products  were  purified  using  Qiagen  PCR 
purification  kit  (Qiagen)  and  sequenced  with  automated  sequencer  ABI  3700  PRISM 
(Applied  Biosystems)  in Iontek  (Istanbul,  Turkey).  The  resulting  sequences  were  aligned 
with the CLUSTAL W program.  
 
4.1.5.  Quantitative Real Time PCR 
 
The  real  time  PCR  was performed  in a  total  volume  of  20 µl,  containing 10  µl  2X 
SYBR Green PCR Master Mix (TaKaRa, Japan), 5 pmol of each primer per reaction, 4 µl 
of the genomic DNA (5 ng/µl) and distilled water. The PCR protocol on Light Cycler (LC) 
(Roche  Diagnostics,  Mannheim,  Germany)  was  as  follows:  an  initial  denaturation  step 
(95°C for 2 min) followed by amplification and quantification steps repeated for  30 cycles 
(95°C for 5 sec, 58°C for 10 sec, 72°C for 20 sec, with a single fluorescence measurement 

 
 
60 
 
at  the  end  of  the  elongation  step  at  72°C),  a  melting  curve  program  (65–98°C  with  a 
heating  rate  of  0.2°C  per  second  and  a  continuous  fluorescence  measurement)  and 
terminated by cooling to 40°C. Each sample was amplified with the MECP2 and reference 
gene  primer  pairs.  The  coding  exons  of  the  MECP2  was  amplified  using  the  following 
primers  designed  by  Bienvenu  et  al.  (2000);  Rett_exon2F:    tttctttgttttaggctcca; 
Rett_exon2R:  ggccaaaccaggacatatac;  Rett_exon3F:  gtgatacttacatacttgtt;  Rett_exon3R: 
ggctcagcagagtggtgggc; 
Rett_exon4F: 
tgtgtctttctgtttgtccc; 
and 
Rett_exon4R: 
gatttgggcttcttaggtgg.  The  reference  NDRG1  gene  was  amplified  using  NDRG1_exon7F: 
aggctcccgtcactctg  and  NDRG1_exon7R:  gtcttccttcatcttaaaatg  primers.  Within  each  PCR 
batch three aliquots of wild type control DNA in decreasing concentrations (20, 10, and 5 
ng)  from  a  healthy  female  were  included  to  construct  a  standard  curve.  Melting  point 
analysis was conducted on all PCR products to check for any nonspecific amplicons. Using 
the  Fit  Points  Method,  the  DNA  was  quantified  relative  to  the  standard  curve  for  each 
exon. Subsequently, the ratios between target (MECP2) and reference (NDRG1) exon were 
calculated for each individual. The ratio was 1.0 for normal individuals, a ratio of 0.5 was 
accepted as a heterozygous deletion, and 1.5 as a heterozygous duplication. 
 
4.1.6.  Quantitative Fluorescent Multiplex PCR Assay 
 
Quantitative  fluorescent  multiplex  PCR  (QF-PCR)  assay  was  used  to  detect  the 
MeCP2 exon 3 rearrangments. Multiplex QF-PCR assay was set up to amplify exon 3 of 
MeCP2  gene  and  exon  2  of  Prion  Protein  (PRNP)  gene  simultaneously.  The  following 
primers  were  used:  6-FAM  labeled  MeCP2-3F:  gagcccgtgcagccatcagc,  MeCp2-3R: 
cgtgtccagccttcaggcag,  6-FAM  labeled  PRNP-2F:  actgcgtcaatatcacaatc,  and  PRNP-2R: 
tccccactatcaggaagatga  (Bienvenu  et  al.,  2000).  Primers  were  at  first  tested  in  equimolar 
amounts and their concentrations were then changed to obtain equal fluorescent peak area 
for  both  MeCP2  and  PRNP  gene.    PCR  was  performed  in  a  total  volume  of  20  µl 
containing  30  ng  genomic  DNA,  10  µl  2X  SYBR  Green  PCR  Master  Mix  (TaKaRa, 
Japan), 5 pmol (for MeCP2) and 7.5 pmol (for PRNP) of each primer. The PCR protocol 
on Light Cycler (LC) (Roche Diagnostics, Mannheim, Germany) was as follows: an initial 
denaturation step (95°C for 2 min) followed by amplification steps repeated for 25 cycles 
of 95°C for 5 sec, 58°C for 10 sec, 72°C for 20 sec and a melting curve program (65–98°C 
with  a  heating  rate  of  0.2°C  per  second).  Melting  point  analysis  and  agarose  gel 

 
 
61 
 
electrophoresis  were  performed  to  check  for  any  nonspecific  amplicons.  Fragments  were 
then electrophoresed on ABI prism 3100 Genetic analyzer and areas under the curve were 
calculated  by  GeneMapper  software  package  (Applied  Biosystem,  Foster  City,  CA)  in 
Burç laboratory, Istanbul.  
 
4.1.7.  X Chromosome Inactivation 
 
X Chromosome Inactivation (XCI) was assessed by the method described by Allen et 
al
. (1992) and Beever et al. (2003). Initially, two µg genomic DNA of the each patient and 
mother was digested with 10U of HhaI restriction enzyme (MBI Fermentas) in a volume of 
20 µl. The mixture was incubated at 37 ºC for overnight. 
     
The HhaI digested and undigested genomic DNAs from the patients were amplified 
by  primers  flanking  the  CAG  repeat  region  in  the  Androgen  Receptor  (AR)  or  ZNF261 
genes  (Table  3.2).  PCR  reaction  was  performed  in  a  total  volume  of  25  µl  containing 
approximately 100 ng DNA, 2.5 µl of 10X polymerase buffer, 1.0 mM MgCl
2
, 10 per cent 
dimethyl  sulfoxide  (DMSO),  200  µM  dNTPs,  0.4  µlM  of  each  primer,  and  1  U  of  Taq 
polymerase (Fermentas). The following PCR program was used: 94ºC for 4 min, followed 
by 35 cycles of 45 sec at 94 ºC, 30 sec at annealing temperature (65ºC for AR-F/R, 58ºC 
for ZNF261-F/R), 1 min at 72ºC, and a final extension step of 8 min at 72ºC. 
  
4.1.7.1.  Preparation of Denaturing Polyacrlamide Gels. The PCR products were analyzed 
on eight per cent denaturing acrylamide gel. The gel was cast in a 40 cm long sequencing 
apparatus  that  was  assembled  using  0.35  mm  spacers.  Four  hundred  µl  of  APS  (10  per 
cent) and 40 µl of TEMED were added in 40 ml of denaturing stock acrylamide solution 
and  poured  between  the  glass  plates.  A  24-well  shark’s  tooth  comb  was  inserted  in  an 
inverted orientation and the gel was allowed to polymerize for at least one hour.  
 
4.1.7.2.  Electrophoresis of PCR Products on Denaturing Polyacrlamide Gels. The gel was 
initially pre-run with hot 1X TBE buffer at constant power of 40 Watts for 15-20 min to 
allow the temperature to rise to 45 ºC. Then, ten µl of the PCR product was mixed with ten 
µl  of  denaturing  loading  dye,  denatured  at  94°C  for  five  min,  and  chilled on  ice  for  five 
min.  After  the  comb  was  re-oriented,  three  µl  of  the  denatured  sample  was  loaded.  The 

 
 
62 
 
gels  were  run  at  30W  constant  power  for  three  hours,  then  silver-stained  and  sealed  for 
documentation.  
 
4.1.8.  Clinical Severity Score Analysis 
 
4.1.8.1.  Clinical Severity Score. Patients were evaluated by a scoring system with respect 
to:  hand  function,  eye  contact  and  gait  function.  The  scoring  was  performed  as  follow:  
Hand function: (1) can hold a glass, can use a spoon or fork; (2) can sometimes grasp an 
object;  (3)  does  never  use  her  hands  purposefully.  Eye  contact:  (1)  intense,  use  eye 
pointing; (2) direct eye contact possible to obtain; (3) eye contact very difficult to obtain. 
Gait  function:  (1)  walks  independently;  (2)  has  lost  gait  function;  (3)  has  never  walked 
(Cheadle et al., 2000). 
 
4.1.8.2.    Huppke  Scoring.  Patients  were  scored  with  respect  to  the  following  criteria: 
Normal  prenatal  and  perinatal  period  (1);  Normal  psychomotor  development  during  the 
first  6  months  (1);  Normal  head  circumference  at  birth  (1);  Deceleration  of  head  growth 
(1); Never good hand skills (1); Loss of hand skills (2); Stereotypic hand movements (1); 
Communication dysfunction and social withdraw (1); Never acquired language (1); Loss of 
acquired language (2); Severe psychomotor retardation (1); Impaired or absent locomotion 
(1) (Huppke et al., 2003). 
 
4.1.8.3.    Statistical  Analyses.  The  non-parametric  Wilcoxon  Mann–Whitney  test  with  a 
significance  level  of  95  per  cent  was  used  for  comparing  total  severity  score  values  of 
samples  with  respect  to  the  presence,  type  and  location  of  the  mutation  in  the  MECP2 
gene,  and  the  XCI  status.  Severity  score  for  specific  clinical  features  of  patients  were 
compared  by  Fisher  exact  test.  All  statistical  analyses  were  performed  by  using  SPSS  v 
15.0 software (SPSS Inc., Chicago, IL, USA). 
 
4.1.9.    Multiplexed  ARMS-PCR  Approach  for  the  Detection  of  Common  MECP2 
Mutations 
 
4.1.9.1.  Primer Design. The multiplex amplification refractory mutation system (ARMS) -
PCR  procedure  was  established  to  identify  seven  of  the  most  common  MECP2  gene 

 
 
63 
 
mutations.  Primers  were  designed  according  to  MECP2  sequence  (GenBank  accession 
NT_004992)  using  web-based  software  Primer  3.0.  The  specificity  of  the  primers  were 
confirmed using the ‘BLAST’’ program at http://www.ncbi.nlm.nih.gov/blast. The primer 
nucleotide  sequences  are given  in  Table  1.  To  increase  the  specificity  of  the  reaction  for 
p.R168X  and  p.T158M  mutations  a  mismatch  is  introduced  at  the  3′  end  of  the 
corresponding  allele-specific  primers.  Each  primer  is  designed  to  amplify  fragments  of 
different  sizes  to  resolve  the  products  easily  on  agarose  gel  electrophoresis  (Figure  4.1). 
Panel  1  can  screen  for  four  of  the  mutations  and  the  corresponding  wild  type  alleles 
(p.R133C,  p.R168X,  p.R255X  and  p.R294X)  whereas  Panel  2  detects  mutant/wild  type 
alleles for p.T158M, p.R270X and p.R306C mutations.  
 
 
Figure 4.1.  Schematic representation of primer positions on MECP2 gene nucleotide 
sequence. 

 
 
64 
 
4.1.9.2.    PCR  conditions.  PCR  was  performed  in  a  total  volume  of  25µl  containing 
approximately 60 ng genomic DNA, 2.5 µl of 10X buffer, 2.5 mM MgCl
2
, 0.2 mM dNTPs, 
and  1.5U  of  Taq  polymerase  (MBI  Fermentas,  Hanover,  MD).  The  concentrations  of 
primers  used  are given  in  Table  4.2. The  PCR  program  on  the  thermal cycler  (icycler
TM

BioRad)  was  as  follows:  an  initial  denaturation  step  at  94  ºC  for  5  min,  a  10  cycles  of 
touchdown PCR consists of 30 sec at 94 ºC, 45 sec at 63 ºC with 0.4 ºC decrement in each 
cycle and 1 min at 72 ºC followed by 35 cycles of 25 sec at 94 ºC, 45 sec at 59 ºC, 1 min at 
72 ºC, and a final extension step of 10 min at 72 ºC.  
 
A  total  of  15  µl  from  the  PCR  product  were  run  on  two  per  cent  standard  agarose 
gels  at  100  V  for  15  min.  The  fragments  were  visualized  by  ethidium  bromide  on  a  UV 
transilluminator. 
 
Table 4.2.  Primer sequences and concentrations used in the two panels for 
multiplexed ARMS-PCR assay. 
Mutation  [conc.]    
   wildtype Primer 
 mutant primer            [conc.]       PCR 
 
 
 
 
 
 
 
 
 
 
 product size 
 
 
 
 
 
 
 
Panel 1-wt 
 
Panel 1-mut 
R133C       5 pmol  
caatcaactccactttagagcG 
caatcaactccactttagagcA     20 pmol           141bp 
R168X       3 pmol 
atcttaggtggtttctgctctcG 
atcttaggtggtttctgctcacA      10 pmol           247bp 
R255X      15 pmol 
gtcggcctcagcttttcG 
gtcggcctcagcttttcA 
     5 pmol           504bp 
R294X      20 pmol           gtacggtctcctgcacagatcG 
gtacggtctcctgcacagatcA       10 pmol           625bp 
Forward     10 pmol 
 
GTTTGTCAGAGCGTTGTCACC                 10 pmol 
 
 
 
 
 
Panel 2-wt 
 
Panel 2-mut 
T158M      10 pmol         ggggctccctctcccagttaccG 
ggggctccctctcccagttaacA      5 pmol 
 220bp 
R270X      10 pmol         accacactccccggctttcG 
accacactccccggctttcA 
      10 pmol 
 551bp 
R306C      10 pmol         gtctcccgggtcttgcG 
gtctcccgggtcttgcA 
      10 pmol 
 656bp 
Forward    10 pmol 
 
GTTTGTCAGAGCGTTGTCACC        
    10 pmol 
 
 
 

 
 
65 
 
4.1.9.3.    p.R106W  mutation  detection.  The  c.316  C>T  (p.R106W)  mutation  was  also 
investigated  by  ARMS-PCR  using  the  following  primers:  wild-type  R106W-R:  5’- 
ctgcctgaaggctggacac  -3’,  mutant  R106W-W:  5’-  ctgcctgaaggctggacat  -3’and  common 
R106W-C:  5’-  gccctgtagagataggagttgc  -3’.  Using  the  above  cycling  conditions  with  10 
pmol primers, a 112 bp long product was produced. 
 
4.1.9.4.  PCR-RFLP and DNA  Sequencing. The mutations p.R106W (+NlaIII), p.T158M 
(+NlaIII),  p.R168X  (+HphI),  p.R270X  (-NlaIV),  and  p.R306C  (-HhaI)  were  screened 
using  PCR-RFLP  whereas  mutations  p.R133C,  p.R255X  and  p.R294X  were  investigated 
by DNA sequencing as described in sections 4.1.3.1 and 4.1.4.  
 
Yüklə 4,8 Kb.

Dostları ilə paylaş:
1   2   3   4   5   6   7   8   9   10   ...   13




Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azkurs.org 2020
rəhbərliyinə müraciət

    Ana səhifə